Transcript: Human NM_014286.4

Homo sapiens neuronal calcium sensor 1 (NCS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NCS1 (23413)
Length:
5164
CDS:
261..833

Additional Resources:

NCBI RefSeq record:
NM_014286.4
NBCI Gene record:
NCS1 (23413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427733 GGCTACAGCCCTCTGCATAAA pLKO_005 1082 3UTR 100% 13.200 18.480 N NCS1 n/a
2 TRCN0000055737 CTCTACGACTTGGACAATGAT pLKO.1 579 CDS 100% 5.625 7.875 N NCS1 n/a
3 TRCN0000055734 GCGAATTGAGTTCTCCGAGTT pLKO.1 494 CDS 100% 4.050 5.670 N NCS1 n/a
4 TRCN0000435844 CTCTACGACGGGCTGGTATAG pLKO_005 813 CDS 100% 3.600 5.040 N NCS1 n/a
5 TRCN0000055733 CCCACCAAGTTTGCCACATTT pLKO.1 441 CDS 100% 13.200 9.240 N NCS1 n/a
6 TRCN0000055735 CCAGAAGATCTACAAGCAATT pLKO.1 404 CDS 100% 10.800 7.560 N NCS1 n/a
7 TRCN0000055736 GAAGACCTACTTTACCGAGAA pLKO.1 314 CDS 100% 4.050 2.835 N NCS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07881 pDONR223 100% 99.8% 100% None 516T>G n/a
2 ccsbBroad304_07881 pLX_304 0% 99.8% 100% V5 516T>G n/a
3 TRCN0000473711 TAAAGTTAATAGTGATTTCTTATA pLX_317 41% 99.8% 100% V5 516T>G n/a
Download CSV