Construct: ORF TRCN0000474275
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015185.1_s317c1
- Derived from:
- ccsbBroadEn_14657
- DNA Barcode:
- TCACTACCAGATTTCAAAAGGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GNAL (2774)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474275
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2774 | GNAL | G protein subunit alpha L | NM_182978.4 | 99.9% | 100% | 243G>T |
| 2 | human | 2774 | GNAL | G protein subunit alpha L | NM_001142339.2 | 78.6% | 75.5% | (many diffs) |
| 3 | human | 2774 | GNAL | G protein subunit alpha L | NM_001261443.1 | 78.6% | 75.5% | (many diffs) |
| 4 | human | 2774 | GNAL | G protein subunit alpha L | NM_001369387.1 | 78.6% | 75.5% | (many diffs) |
| 5 | human | 2774 | GNAL | G protein subunit alpha L | XM_006722324.3 | 52.3% | 52.4% | 243G>T;720_721ins654 |
| 6 | human | 2774 | GNAL | G protein subunit alpha L | NM_001261444.2 | 37.9% | 37.9% | 0_1ins852 |
| 7 | mouse | 14680 | Gnal | guanine nucleotide binding ... | NM_177137.5 | 85.3% | 91% | (many diffs) |
| 8 | mouse | 14680 | Gnal | guanine nucleotide binding ... | NM_010307.3 | 73.1% | 75.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1440
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tctgtgctac agtctgcggc cgctgctttt cgggggccca ggggacgacc 121 cctgcgcggc ctcggagccg ccggtggagg acgcgcagcc cgccccggcc ccggccctgg 181 ccccagtccg ggcggccgca agggacacgg cccggaccct gctccctcgg ggcggcgaag 241 ggagcccggc atgcgctcgg cccaaagcag acaagccgaa ggagaagcgg cagcgcaccg 301 agcagcttag tgccgaggag cgcgaggcgg ccaaggagcg cgaggcggtc aaggaggcga 361 ggaaagtgag ccggggcatc gaccgcatgc tgcgcgacca gaagcgcgac ctgcagcaga 421 cgcaccggct cctgctgctc ggggctggtg agtctgggaa aagcactatc gtcaaacaga 481 tgaggatcct gcacgtcaat gggtttaatc ccgaggaaaa gaaacagaaa attctggaca 541 tccggaaaaa tgttaaagat gctatcgtga caattgtttc agcaatgagt actataatac 601 ctccagttcc gctggccaac cctgaaaacc aatttcgatc agactacatc aagagcatag 661 cccctatcac tgactttgaa tattcccagg aattctttga ccatgtgaaa aaactttggg 721 acgatgaagg cgtgaaggca tgctttgaga gatccaacga ataccagctg attgactgtg 781 cacaatactt cctggaaaga atcgacagcg tcagcttggt tgactacaca cccacagacc 841 aggacctcct cagatgcaga gttctgacat ctgggatttt tgagacacga ttccaagtgg 901 acaaagtaaa cttcCACATG TTTGATGTTG GTGGCCAGAG GGATGAGAGG AGAAAATGGA 961 TCCAGTGCTT TAACGATGTC ACAGCTATCA TTTACGTCGC AGCCTGCAGT AGCTACAACA 1021 TGGTGATTCG AGAAGATAAC AACACCAACA GGCTGAGAGA GTCCCTGGAT CTTTTTGAAA 1081 GCATCTGGAA CAACAGGTGG TTACGGACCA TTTCTATCAT CTTGTTCTTG AACAAACAAG 1141 ATATGCTGGC AGAAAAAGTC TTGGCAGGGA AATCAAAAAT TGAAGACTAT TTCCCAGAAT 1201 ATGCAAATTA TACTGTTCCT GAAGACGCAA CACCAGATGC AGGAGAAGAT CCCAAAGTTA 1261 CAAGAGCCAA GTTCTTTATC CGGGACCTGT TTTTGAGGAT CAGCACGGCC ACCGGTGACG 1321 GCAAACATTA CTGCTACCCG CACTTCACCT GCGCCGTGGA CACAGAGAAC ATCCGCAGGG 1381 TGTTCAACGA CTGCCGCGAC ATCATCCAGC GGATGCACCT CAAGCAGTAT GAGCTCTTGT 1441 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGATCACT ACCAGATTTC AAAAGGGCAA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt