Transcript: Human NM_001369387.1

Homo sapiens G protein subunit alpha L (GNAL), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GNAL (2774)
Length:
6045
CDS:
350..1495

Additional Resources:

NCBI RefSeq record:
NM_001369387.1
NBCI Gene record:
GNAL (2774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424620 CACCGGTGACGGCAAACATTA pLKO_005 1363 CDS 100% 13.200 18.480 N GNAL n/a
2 TRCN0000036481 CCAATTTCGATCAGACTACAT pLKO.1 682 CDS 100% 4.950 6.930 N GNAL n/a
3 TRCN0000036479 GCTTTGAGAGATCCAACGAAT pLKO.1 795 CDS 100% 4.950 6.930 N GNAL n/a
4 TRCN0000115015 GACACGATTCCAAGTGGACAA pLKO.1 937 CDS 100% 4.050 5.670 N Gnal n/a
5 TRCN0000036482 GCTTTAACGATGTCACAGCTA pLKO.1 1020 CDS 100% 2.640 3.696 N GNAL n/a
6 TRCN0000417142 GTTTCAGCAATGAGTACTATA pLKO_005 629 CDS 100% 13.200 9.240 N GNAL n/a
7 TRCN0000423280 TGCACGTCAATGGGTTTAATC pLKO_005 543 CDS 100% 13.200 9.240 N GNAL n/a
8 TRCN0000422156 CTGATTGACTGTGCACAATAC pLKO_005 821 CDS 100% 10.800 7.560 N GNAL n/a
9 TRCN0000429859 GTAGCTACAACATGGTGATTC pLKO_005 1062 CDS 100% 10.800 7.560 N GNAL n/a
10 TRCN0000036483 CCTCAAGCAGTATGAGCTCTT pLKO.1 1471 CDS 100% 4.050 2.835 N GNAL n/a
11 TRCN0000036480 GCAAATTATACTGTTCCTGAA pLKO.1 1256 CDS 100% 4.050 2.835 N GNAL n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2785 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4271 3UTR 100% 4.950 2.475 Y LOC387873 n/a
14 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 2840 3UTR 100% 4.050 2.025 Y INTS7 n/a
15 TRCN0000097642 CACTATCGTCAAACAGATGAA pLKO.1 517 CDS 100% 4.950 2.970 N LOC239863 n/a
16 TRCN0000184969 CACTATCGTCAAACAGATGAA pLKO.1 517 CDS 100% 4.950 2.970 N LOC239863 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2786 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4308 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4308 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487707 TGCGATTCTGGCCGACCTTATCAC pLX_317 25.3% 99.3% 100% V5 (not translated due to prior stop codon) 1143_1144insTGAAAGCT n/a
2 ccsbBroadEn_14657 pDONR223 96.8% 78.6% 75.5% None (many diffs) n/a
3 ccsbBroad304_14657 pLX_304 42% 78.6% 75.5% V5 (many diffs) n/a
4 TRCN0000474275 TCACTACCAGATTTCAAAAGGGCA pLX_317 38.4% 78.6% 75.5% V5 (many diffs) n/a
5 TRCN0000487797 CAACAAACAGTAACTTGAGACCAT pLX_317 21.1% 78.2% 75.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV