Construct: ORF TRCN0000474282
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007789.1_s317c1
- Derived from:
- ccsbBroadEn_14373
- DNA Barcode:
- TAATTGTGAAAGGAATTACCCCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MBOAT2 (129642)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474282
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NM_001321266.2 | 90.3% | 90.1% | 1_111del;785C>A |
2 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NM_001321265.2 | 81.1% | 80.9% | 1_243del;917C>A |
3 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NM_001321267.2 | 81.1% | 80.9% | 1_243del;917C>A |
4 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NM_138799.4 | 67.2% | 67.1% | 1_510del;1184C>A |
5 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | XM_011510313.1 | 31.9% | 31.3% | 1_510del;986_1001del;1029_1030ins547 |
6 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | XM_011510314.3 | 31.9% | 31.3% | 1_510del;986_1001del;1029_1030ins547 |
7 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135605.2 | 14% | (many diffs) | |
8 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135600.2 | 13.9% | (many diffs) | |
9 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135604.2 | 13.7% | (many diffs) | |
10 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135598.2 | 13.6% | (many diffs) | |
11 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135603.2 | 13.5% | (many diffs) | |
12 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135599.2 | 13.2% | (many diffs) | |
13 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135601.2 | 12.8% | (many diffs) | |
14 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135606.2 | 12.4% | (many diffs) | |
15 | human | 129642 | MBOAT2 | membrane bound O-acyltransf... | NR_135602.2 | 12% | 1_580del;1122_1123ins133;1498_7489del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1116
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc aagcttactg gagtatttga gttacaactg taacttcatg gggatcctgg 121 caggcccact ttgctcttac aaagactaca ttactttcat tgaaggcaga tcataccata 181 tcacacaatc tggtgaaaat ggaaaagaag agacacagta tgaaagaaca gagccatctc 241 caaatactgc ggttgttcag aagctcttag tttgtgggct gtccttgtta tttcacttga 301 ccatctgtac aacattacct gtggagtaca acattgatga gcattttcaa gctacagctt 361 cgtggccaac aaagattatc tatctgtata tctctctttt ggctgccaga cccaaatact 421 attttgcatg gacgctagct gatgccatta ataatgctgc aggctttggt ttcagagggt 481 atgacgaaaa tggagcagct cgctgggact taatttccaa tttgagaatt caacaaatag 541 agatgtcaac aagtttcaag atgtttcttg ataattggaa tattcagaca gctctttggc 601 tcaaaagggt gtgttatgaa cgaacctcct tcagtccaac tatccagacg ttcattctct 661 ctgccatttG GCACGGGGTA TACCCAGGAT ATTATCTAAC GTTTCTAACA GGGGTGTTAA 721 TGACATTAGC AGCAAGAGAT ATGAGAAATA ACTTTAGACA TTATTTCATT GAACCTTCCC 781 AACTGAAATT ATTTTATGAT GTTATAACAT GGATAGTAAC TCAAGTAGCA ATAAGTTACA 841 CAGTTGTGCC ATTTGTGCTT CTTTCTATAA AACCATCACT CACGTTTTAC AGCTCCTGGT 901 ATTATTGCCT GCACATTCTT GGTATCTTAG TATTATTGTT GTTGCCAGTG AAAAAAACTC 961 AAAGAAGAAA GAATACACAT GAAAACATTC AGCTCTCACA ATCCAAAAAG TTTGATGAAG 1021 GAGAAAATTC TTTGGGACAG AACAGTTTTT CTACAACAAA CAATGTTTGC AATCAGAATC 1081 AAGAAATAGC CTCGAGACAT TCATCACTAA AGCAGTGCCC AACTTTCTTG TACAAAGTGG 1141 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1201 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1261 ATAATTGTGA AAGGAATTAC CCCAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1321 aatttgtgaa agatt