Transcript: Human XM_011510313.1

PREDICTED: Homo sapiens membrane bound O-acyltransferase domain containing 2 (MBOAT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBOAT2 (129642)
Length:
1216
CDS:
97..1128

Additional Resources:

NCBI RefSeq record:
XM_011510313.1
NBCI Gene record:
MBOAT2 (129642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310663 GCCATTTGGTTTCGAACTTAT pLKO_005 211 CDS 100% 13.200 10.560 N MBOAT2 n/a
2 TRCN0000217116 CAGGCCCAATGATGATCATTA pLKO.1 488 CDS 100% 13.200 9.240 N Mboat2 n/a
3 TRCN0000248024 CAGGCCCAATGATGATCATTA pLKO_005 488 CDS 100% 13.200 9.240 N Mboat2 n/a
4 TRCN0000370670 CAGGCCCAATGATGATCATTA pLKO_005 488 CDS 100% 13.200 9.240 N MBOAT2 n/a
5 TRCN0000035240 GCTCTTACAAAGACTACATTA pLKO.1 674 CDS 100% 13.200 9.240 N MBOAT2 n/a
6 TRCN0000291673 GCTCTTACAAAGACTACATTA pLKO_005 674 CDS 100% 13.200 9.240 N MBOAT2 n/a
7 TRCN0000303283 TTGACCATCTGTACAACATTA pLKO_005 838 CDS 100% 13.200 9.240 N MBOAT2 n/a
8 TRCN0000174368 CCTTACACTTTCTTGTACAAA pLKO.1 323 CDS 100% 5.625 3.938 N Mboat2 n/a
9 TRCN0000035239 CGAGTCTATATCTTTGACTAT pLKO.1 445 CDS 100% 4.950 3.465 N MBOAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14373 pDONR223 100% 31.9% 31.3% None 1_510del;986_1001del;1029_1030ins547 n/a
2 ccsbBroad304_14373 pLX_304 0% 31.9% 31.3% V5 1_510del;986_1001del;1029_1030ins547 n/a
3 TRCN0000474282 TAATTGTGAAAGGAATTACCCCAA pLX_317 42.7% 31.9% 31.3% V5 1_510del;986_1001del;1029_1030ins547 n/a
Download CSV