Transcript: Human NR_135602.2

Homo sapiens membrane bound O-acyltransferase domain containing 2 (MBOAT2), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MBOAT2 (129642)
Length:
7489
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135602.2
NBCI Gene record:
MBOAT2 (129642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370550 TTTACAGCTCCTGGTATTATT pLKO_005 1268 3UTR 100% 15.000 12.000 N MBOAT2 n/a
2 TRCN0000310663 GCCATTTGGTTTCGAACTTAT pLKO_005 185 3UTR 100% 13.200 10.560 N MBOAT2 n/a
3 TRCN0000217116 CAGGCCCAATGATGATCATTA pLKO.1 462 3UTR 100% 13.200 9.240 N Mboat2 n/a
4 TRCN0000248024 CAGGCCCAATGATGATCATTA pLKO_005 462 3UTR 100% 13.200 9.240 N Mboat2 n/a
5 TRCN0000370670 CAGGCCCAATGATGATCATTA pLKO_005 462 3UTR 100% 13.200 9.240 N MBOAT2 n/a
6 TRCN0000303284 CTTGCCTTAAACCCTCTATTT pLKO_005 1877 3UTR 100% 13.200 9.240 N MBOAT2 n/a
7 TRCN0000035240 GCTCTTACAAAGACTACATTA pLKO.1 648 3UTR 100% 13.200 9.240 N MBOAT2 n/a
8 TRCN0000291673 GCTCTTACAAAGACTACATTA pLKO_005 648 3UTR 100% 13.200 9.240 N MBOAT2 n/a
9 TRCN0000303283 TTGACCATCTGTACAACATTA pLKO_005 812 3UTR 100% 13.200 9.240 N MBOAT2 n/a
10 TRCN0000174368 CCTTACACTTTCTTGTACAAA pLKO.1 297 3UTR 100% 5.625 3.938 N Mboat2 n/a
11 TRCN0000035239 CGAGTCTATATCTTTGACTAT pLKO.1 419 3UTR 100% 4.950 3.465 N MBOAT2 n/a
12 TRCN0000175588 CCAAATGAATGTCTTGCCTTA pLKO.1 1865 3UTR 100% 4.050 2.835 N Mboat2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3383 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3383 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3383 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3510 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14373 pDONR223 100% 12% None 1_580del;1122_1123ins133;1498_7489del n/a
2 ccsbBroad304_14373 pLX_304 0% 12% V5 1_580del;1122_1123ins133;1498_7489del n/a
3 TRCN0000474282 TAATTGTGAAAGGAATTACCCCAA pLX_317 42.7% 12% V5 1_580del;1122_1123ins133;1498_7489del n/a
Download CSV