Construct: ORF TRCN0000474406
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011170.1_s317c1
- Derived from:
- ccsbBroadEn_02579
- DNA Barcode:
- GCATACCCCAATCAGCATGTCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YWHAQ (10971)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474406
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10971 | YWHAQ | tyrosine 3-monooxygenase/tr... | NM_006826.4 | 100% | 100% | |
| 2 | mouse | 22630 | Ywhaq | tyrosine 3-monooxygenase/tr... | NM_011739.3 | 93.7% | 99.5% | (many diffs) |
| 3 | mouse | 666202 | Gm7977 | predicted gene 7977; tyrosi... | NR_040408.1 | 86.5% | (many diffs) | |
| 4 | mouse | 100039786 | Gm2423 | predicted gene 2423 | XR_873139.1 | 46.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaagactgag ctgatccaga aggccaagct ggccgagcag gccgagcgct 121 acgacgacat ggccacctgc atgaaggcag tgaccgagca gggcgccgag ctgtccaacg 181 aggagcgcaa cctgctctcc gtggcctaca agaacgtggt cgggggccgc aggtccgcct 241 ggagggtcat ctctagcatc gagcagaaga ccgacacctc cgacaagaag ttgcagctga 301 ttaaggacta tcgggagaaa gtggagtccg agctgagatc catctgcacc acggtgctgg 361 aattgttgga taaatattta atagccaatg caactaatcc agagagtaag gtcttctatc 421 tgaaaatgaa gggtgattac tTCCGGTACC TTGCTGAAGT TGCGTGTGGT GATGATCGAA 481 AACAAACGAT AGATAATTCC CAAGGAGCTT ACCAAGAGGC ATTTGATATA AGCAAGAAAG 541 AGATGCAACC CACACACCCA ATCCGCCTGG GGCTTGCTCT TAACTTTTCT GTATTTTACT 601 ATGAGATTCT TAATAACCCA GAGCTTGCCT GCACGCTGGC TAAAACGGCT TTTGATGAGG 661 CCATTGCTGA ACTTGATACA CTGAATGAAG ACTCATACAA AGACAGCACC CTCATCATGC 721 AGTTGCTTAG AGACAACCTA ACACTTTGGA CATCAGACAG TGCAGGAGAA GAATGTGATG 781 CGGCAGAAGG GGCTGAAAAC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 841 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 901 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCAT ACCCCAATCA 961 GCATGTCTTT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt