Transcript: Mouse XR_873139.1

PREDICTED: Mus musculus predicted gene 2423 (Gm2423), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2423 (100039786)
Length:
1471
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_873139.1
NBCI Gene record:
Gm2423 (100039786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_873139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313483 TTTGTATTACTGCGAAGATAT pLKO_005 1132 3UTR 100% 13.200 6.600 Y Ywhaq n/a
2 TRCN0000413513 TAATAGCCAATGCAACTAATC pLKO_005 382 3UTR 100% 10.800 5.400 Y YWHAQ n/a
3 TRCN0000349888 TGAACGAAGACTCCTACAAAG pLKO_005 685 3UTR 100% 10.800 5.400 Y Ywhaq n/a
4 TRCN0000076393 CCAGAGAGTAAGGTCTTCTAT pLKO.1 402 3UTR 100% 5.625 2.813 Y Ywhaq n/a
5 TRCN0000312371 CCAGAGAGTAAGGTCTTCTAT pLKO_005 402 3UTR 100% 5.625 2.813 Y Ywhaq n/a
6 TRCN0000076394 CCTGGAATTGTTGGATAAGTA pLKO.1 359 3UTR 100% 5.625 2.813 Y Ywhaq n/a
7 TRCN0000312370 CCTGGAATTGTTGGATAAGTA pLKO_005 359 3UTR 100% 5.625 2.813 Y Ywhaq n/a
8 TRCN0000076397 ATCAAGGACTATCGGGAGAAA pLKO.1 303 3UTR 100% 4.950 2.475 Y Ywhaq n/a
9 TRCN0000076396 CATCTCGAGCATTGAGCAGAA pLKO.1 251 3UTR 100% 0.000 0.000 Y Ywhaq n/a
10 TRCN0000312369 CATCTCGAGCATTGAGCAGAA pLKO_005 251 3UTR 100% 0.000 0.000 Y Ywhaq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_873139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02579 pDONR223 100% 46.7% None (many diffs) n/a
2 ccsbBroad304_02579 pLX_304 0% 46.7% V5 (many diffs) n/a
3 TRCN0000474406 GCATACCCCAATCAGCATGTCTTT pLX_317 49% 46.7% V5 (many diffs) n/a
Download CSV