Transcript: Human NM_006826.4

Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta (YWHAQ), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
YWHAQ (10971)
Length:
2196
CDS:
140..877

Additional Resources:

NCBI RefSeq record:
NM_006826.4
NBCI Gene record:
YWHAQ (10971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414880 AGTCCGAGCTGAGATCCATCT pLKO_005 399 CDS 100% 4.050 5.670 N YWHAQ n/a
2 TRCN0000078171 GCTTAGAGACAACCTAACACT pLKO.1 799 CDS 100% 3.000 4.200 N YWHAQ n/a
3 TRCN0000078170 CAAACGATAGATAATTCCCAA pLKO.1 557 CDS 100% 2.640 3.696 N YWHAQ n/a
4 TRCN0000426880 GAGCTTACCAAGAGGCATTTG pLKO_005 579 CDS 100% 10.800 7.560 N YWHAQ n/a
5 TRCN0000413513 TAATAGCCAATGCAACTAATC pLKO_005 453 CDS 100% 10.800 7.560 N YWHAQ n/a
6 TRCN0000415717 ACCACGGTGCTGGAATTGTTG pLKO_005 422 CDS 100% 4.950 3.465 N YWHAQ n/a
7 TRCN0000078168 GCCCTATGTAACAGCAGAGTA pLKO.1 1846 3UTR 100% 4.950 3.465 N YWHAQ n/a
8 TRCN0000078169 GCTGAACTTGATACACTGAAT pLKO.1 740 CDS 100% 4.950 3.465 N YWHAQ n/a
9 TRCN0000429655 TGCGTGTGGTGATGATCGAAA pLKO_005 535 CDS 100% 4.950 3.465 N YWHAQ n/a
10 TRCN0000078172 CAGTTGCTTAGAGACAACCTA pLKO.1 794 CDS 100% 3.000 2.100 N YWHAQ n/a
11 TRCN0000076393 CCAGAGAGTAAGGTCTTCTAT pLKO.1 473 CDS 100% 5.625 3.375 N Ywhaq n/a
12 TRCN0000312371 CCAGAGAGTAAGGTCTTCTAT pLKO_005 473 CDS 100% 5.625 3.375 N Ywhaq n/a
13 TRCN0000071053 CCATTGCTGAACTTGATACAT pLKO.1 735 CDS 100% 5.625 2.813 Y Ywhaz n/a
14 TRCN0000316383 CCATTGCTGAACTTGATACAT pLKO_005 735 CDS 100% 5.625 2.813 Y Ywhaz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02579 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02579 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474406 GCATACCCCAATCAGCATGTCTTT pLX_317 49% 100% 100% V5 n/a
Download CSV