Construct: ORF TRCN0000474593
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001987.1_s317c1
- Derived from:
- ccsbBroadEn_01026
- DNA Barcode:
- AAGCGGAACGTCTCCGGGCCGGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MNAT1 (4331)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474593
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | NM_002431.4 | 100% | 100% | |
| 2 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_005267687.3 | 100% | 100% | |
| 3 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_017021332.2 | 92.5% | 89.4% | (many diffs) |
| 4 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_005267688.3 | 88.9% | 87.3% | (many diffs) |
| 5 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | NM_001177963.2 | 86.4% | 86.4% | 559_560ins126 |
| 6 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_017021333.2 | 60.8% | 60.8% | 0_1ins363 |
| 7 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_017021334.2 | 60.8% | 60.8% | 0_1ins363 |
| 8 | human | 4331 | MNAT1 | MNAT1 component of CDK acti... | XM_024449599.1 | 60.8% | 60.8% | 0_1ins363 |
| 9 | mouse | 17420 | Mnat1 | menage a trois 1 | NM_008612.2 | 86.9% | 95.4% | (many diffs) |
| 10 | mouse | 17420 | Mnat1 | menage a trois 1 | XM_006515526.2 | 51.2% | 56.6% | (many diffs) |
| 11 | mouse | 17420 | Mnat1 | menage a trois 1 | XM_011244008.2 | 51.2% | 56.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 993
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgatcagggt tgccctcggt gtaagaccac caaatatcgg aacccctcct 121 tgaagctgat ggtgaatgtg tgcggacaca ctctctgtga aagttgtgta gatttactgt 181 ttgtgagagg agctggaaac tgccctgagt gtggtactcc actcagaaag agcaacttca 241 gggtacaact ctttgaagat cccactgttg acaaggaggt tgagatcagg aaaaaagtgc 301 taaagatata caataaaagg gaagaagatt ttcctagtct aagagaatac aatgatttct 361 tggaagaagt ggaagaaatt gttttcaact tgaccaacaa tgtggatttg gacaacacca 421 aaaagaaaat ggagatatac caaaaggaaa acaaagatgt tattcagaaa aataaattaa 481 agctgactcg agaacaggaa gaactggaag aagctttaga agtggaacga caggaaaatg 541 aacaaagaag attatttata caaaaagaag aaCAACTGCA GCAGATTCTA AAAAGGAAGA 601 ATAAGCAGGC TTTTTTAGAT GAGCTGGAGA GTTCTGATCT CCCTGTTGCT CTGCTTTTGG 661 CTCAGCATAA AGATAGATCT ACCCAATTAG AAATGCAACT TGAGAAACCC AAACCTGTAA 721 AACCAGTGAC GTTTTCCACA GGCATCAAAA TGGGTCAACA TATTTCACTG GCACCTATTC 781 ACAAGCTTGA AGAAGCTCTG TATGAATACC AGCCACTGCA GATAGAGACA TATGGACCAC 841 ATGTTCCTGA GCTTGAGATG CTAGGAAGAC TTGGGTATTT AAACCATGTC AGAGCTGCCT 901 CACCACAGGA CCTTGCTGGA GGCTATACTT CTTCTCTTGC TTGTCACAGA GCACTACAGG 961 ATGCATTCAG TGGGCTTTTC TGGCAGCCCA GTTACCCAAC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAA 1141 GCGGAACGTC TCCGGGCCGG CGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt