Transcript: Mouse NM_008612.2

Mus musculus menage a trois 1 (Mnat1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mnat1 (17420)
Length:
2505
CDS:
122..1051

Additional Resources:

NCBI RefSeq record:
NM_008612.2
NBCI Gene record:
Mnat1 (17420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039541 GTTGATAAGGAGGTTGAAATT pLKO.1 323 CDS 100% 13.200 9.240 N Mnat1 n/a
2 TRCN0000039539 GTGTGGACTTACTGTTTGTAA pLKO.1 222 CDS 100% 5.625 3.938 N Mnat1 n/a
3 TRCN0000039542 ACAGATTTCATTAGCACCAAT pLKO.1 814 CDS 100% 4.950 3.465 N Mnat1 n/a
4 TRCN0000019945 GCTATACTTCTTCTCTTGCTT pLKO.1 978 CDS 100% 3.000 2.100 N MNAT1 n/a
5 TRCN0000278491 GCTATACTTCTTCTCTTGCTT pLKO_005 978 CDS 100% 3.000 2.100 N MNAT1 n/a
6 TRCN0000039540 CGCAGCATAAAGACAGATCGA pLKO.1 717 CDS 100% 2.640 1.848 N Mnat1 n/a
7 TRCN0000039543 GACTCCACTGAGAAAGAGCAA pLKO.1 271 CDS 100% 2.640 1.584 N Mnat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01026 pDONR223 100% 86.9% 95.4% None (many diffs) n/a
2 ccsbBroad304_01026 pLX_304 0% 86.9% 95.4% V5 (many diffs) n/a
3 TRCN0000474593 AAGCGGAACGTCTCCGGGCCGGCG pLX_317 45.5% 86.9% 95.4% V5 (many diffs) n/a
Download CSV