Transcript: Human XM_005267687.3

PREDICTED: Homo sapiens MNAT1 component of CDK activating kinase (MNAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MNAT1 (4331)
Length:
1194
CDS:
95..1024

Additional Resources:

NCBI RefSeq record:
XM_005267687.3
NBCI Gene record:
MNAT1 (4331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019947 CTCTGTGAAAGTTGTGTAGAT pLKO.1 182 CDS 100% 4.950 6.930 N MNAT1 n/a
2 TRCN0000278546 CTCTGTGAAAGTTGTGTAGAT pLKO_005 182 CDS 100% 4.950 6.930 N MNAT1 n/a
3 TRCN0000019944 CCTAGTCTAAGAGAATACAAT pLKO.1 362 CDS 100% 5.625 4.500 N MNAT1 n/a
4 TRCN0000278543 CCTAGTCTAAGAGAATACAAT pLKO_005 362 CDS 100% 5.625 4.500 N MNAT1 n/a
5 TRCN0000019948 GCCACTGCAGATAGAGACATA pLKO.1 841 CDS 100% 4.950 3.465 N MNAT1 n/a
6 TRCN0000278542 GCCACTGCAGATAGAGACATA pLKO_005 841 CDS 100% 4.950 3.465 N MNAT1 n/a
7 TRCN0000019945 GCTATACTTCTTCTCTTGCTT pLKO.1 951 CDS 100% 3.000 2.100 N MNAT1 n/a
8 TRCN0000278491 GCTATACTTCTTCTCTTGCTT pLKO_005 951 CDS 100% 3.000 2.100 N MNAT1 n/a
9 TRCN0000019946 GTGGATTTGGACAACACCAAA pLKO.1 431 CDS 100% 0.495 0.347 N MNAT1 n/a
10 TRCN0000278490 GTGGATTTGGACAACACCAAA pLKO_005 431 CDS 100% 0.495 0.347 N MNAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267687.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01026 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01026 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474593 AAGCGGAACGTCTCCGGGCCGGCG pLX_317 45.5% 100% 100% V5 n/a
Download CSV