Transcript: Human XM_017021334.2

PREDICTED: Homo sapiens MNAT1 component of CDK activating kinase (MNAT1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MNAT1 (4331)
Length:
2775
CDS:
677..1243

Additional Resources:

NCBI RefSeq record:
XM_017021334.2
NBCI Gene record:
MNAT1 (4331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019948 GCCACTGCAGATAGAGACATA pLKO.1 1060 CDS 100% 4.950 3.465 N MNAT1 n/a
2 TRCN0000278542 GCCACTGCAGATAGAGACATA pLKO_005 1060 CDS 100% 4.950 3.465 N MNAT1 n/a
3 TRCN0000019945 GCTATACTTCTTCTCTTGCTT pLKO.1 1170 CDS 100% 3.000 2.100 N MNAT1 n/a
4 TRCN0000278491 GCTATACTTCTTCTCTTGCTT pLKO_005 1170 CDS 100% 3.000 2.100 N MNAT1 n/a
5 TRCN0000019946 GTGGATTTGGACAACACCAAA pLKO.1 650 5UTR 100% 0.495 0.347 N MNAT1 n/a
6 TRCN0000278490 GTGGATTTGGACAACACCAAA pLKO_005 650 5UTR 100% 0.495 0.347 N MNAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01026 pDONR223 100% 60.8% 60.8% None 0_1ins363 n/a
2 ccsbBroad304_01026 pLX_304 0% 60.8% 60.8% V5 0_1ins363 n/a
3 TRCN0000474593 AAGCGGAACGTCTCCGGGCCGGCG pLX_317 45.5% 60.8% 60.8% V5 0_1ins363 n/a
Download CSV