Construct: ORF TRCN0000474594
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008260.1_s317c1
- Derived from:
- ccsbBroadEn_08269
- DNA Barcode:
- TCCGTGGTCTGCCCAGGTTGACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DNAJC27 (51277)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474594
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51277 | DNAJC27 | DnaJ heat shock protein fam... | NM_016544.3 | 99.8% | 100% | 33C>T |
| 2 | human | 51277 | DNAJC27 | DnaJ heat shock protein fam... | XM_011532902.1 | 69.3% | 64% | (many diffs) |
| 3 | human | 51277 | DNAJC27 | DnaJ heat shock protein fam... | NM_001198559.1 | 64.3% | 64.4% | 33C>T;528_529delGG;531_532ins290 |
| 4 | human | 51277 | DNAJC27 | DnaJ heat shock protein fam... | XR_244938.2 | 16.2% | (many diffs) | |
| 5 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | NM_153082.4 | 89.7% | 93.4% | (many diffs) |
| 6 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XM_006515052.3 | 82.2% | 85.5% | (many diffs) |
| 7 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_381183.3 | 57.5% | (many diffs) | |
| 8 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_381184.3 | 17.3% | (many diffs) | |
| 9 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_381181.3 | 16% | (many diffs) | |
| 10 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_381182.3 | 15.7% | (many diffs) | |
| 11 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_872399.2 | 7.9% | (many diffs) | |
| 12 | mouse | 217378 | Dnajc27 | DnaJ heat shock protein fam... | XR_872397.2 | 7.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 885
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggaatgga ggccaacatg ccgaagcgga aggagcctgg caggtctctc cgcatcaaag 121 tcatctccat gggcaacgcc gaagtgggga aaagctgtat tataaagcga tactgtgaga 181 aaagattcgt gtctaaatac ctggcaacaa ttggaattga ctatggagtc acaaaggtac 241 acgtcagaga cagagaaatc aaagttaaca tctttgatat ggctggacat cccttcttct 301 atgaggttcg aaatgagttt tacaaggaca cacagggtgt gatactggtc tatgatgttg 361 ggcagaaaga ctcctttgac gcccttgatg cgtggctggc agaaatgaag caagagcttg 421 gacctcatgg aaacatggaa aatattatat ttgtagtttg tgccaacaag attgattgta 481 CCAAACATCG CTGTGTAGAT GAAAGTGAAG GACGTCTTTG GGCTGAAAGC AAAGGGTTCC 541 TGTACTTTGA AACTTCAGCA CAAACTGGAG AAGGCATTAA TGAGATGTTC CAGACCTTTT 601 ATATATCCAT AGTTGATTTA TGTGAAAATG GCGGGAAACG CCCTACCACC AATAGCAGTG 661 CTAGTTTCAC CAAAGAACAA GCAGATGCCA TTCGCAGAAT TCGAAATAGT AAAGACAGTT 721 GGGACATGCT GGGAGTCAAA CCTGGGGCCT CAAGGGATGA AGTCAATAAA GCGTATCGGA 781 AACTTGCTGT GCTTCTTCAC CCTGACAAAT GTGTAGCACC TGGCAGTGAA GATGCCTTCA 841 AAGCAGTTGT GAATGCTCGG ACAGCCCTCC TGAAAAACAT CAAGTACCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1021 GAAAGGACGA TCCGTGGTCT GCCCAGGTTG ACGGACGCGT TAAGTCgaca atcaacctct 1081 ggattacaaa atttgtgaaa gatt