Transcript: Human XM_011532902.1

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C27 (DNAJC27), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC27 (51277)
Length:
802
CDS:
166..744

Additional Resources:

NCBI RefSeq record:
XM_011532902.1
NBCI Gene record:
DNAJC27 (51277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217962 TCTTCTATGAGGTTCGAAATG pLKO_005 395 CDS 100% 10.800 8.640 N DNAJC27 n/a
2 TRCN0000217961 TCTAAATACCTGGCAACAATT pLKO_005 292 CDS 100% 13.200 9.240 N DNAJC27 n/a
3 TRCN0000218260 TTGTGCCAACAAGATTGATTG pLKO_005 558 CDS 100% 10.800 7.560 N DNAJC27 n/a
4 TRCN0000029796 GCTGGACATCCCTTCTTCTAT pLKO.1 382 CDS 100% 5.625 3.938 N DNAJC27 n/a
5 TRCN0000029798 GTCTATGATGTTGGGCAGAAA pLKO.1 448 CDS 100% 4.950 3.465 N DNAJC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08269 pDONR223 100% 69.3% 64% None (many diffs) n/a
2 ccsbBroad304_08269 pLX_304 0% 69.3% 64% V5 (many diffs) n/a
3 TRCN0000474594 TCCGTGGTCTGCCCAGGTTGACGG pLX_317 49.4% 69.3% 64% V5 (many diffs) n/a
Download CSV