Transcript: Human XR_244938.2

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C27 (DNAJC27), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC27 (51277)
Length:
5049
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244938.2
NBCI Gene record:
DNAJC27 (51277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229906 ACCAATAGCAGTGCTAGTTTC pLKO_005 834 3UTR 100% 10.800 8.640 N DNAJC27 n/a
2 TRCN0000217962 TCTTCTATGAGGTTCGAAATG pLKO_005 395 3UTR 100% 10.800 8.640 N DNAJC27 n/a
3 TRCN0000229907 TGTGAAAGCAGAGTCTATAAA pLKO_005 4880 3UTR 100% 15.000 10.500 N DNAJC27 n/a
4 TRCN0000029794 CCTCAAGGGATGAAGTCAATA pLKO.1 934 3UTR 100% 13.200 9.240 N DNAJC27 n/a
5 TRCN0000217961 TCTAAATACCTGGCAACAATT pLKO_005 292 3UTR 100% 13.200 9.240 N DNAJC27 n/a
6 TRCN0000218260 TTGTGCCAACAAGATTGATTG pLKO_005 558 3UTR 100% 10.800 7.560 N DNAJC27 n/a
7 TRCN0000029796 GCTGGACATCCCTTCTTCTAT pLKO.1 382 3UTR 100% 5.625 3.938 N DNAJC27 n/a
8 TRCN0000029797 GCCTTCAAAGCAGTTGTGAAT pLKO.1 1020 3UTR 100% 4.950 3.465 N DNAJC27 n/a
9 TRCN0000029798 GTCTATGATGTTGGGCAGAAA pLKO.1 448 3UTR 100% 4.950 3.465 N DNAJC27 n/a
10 TRCN0000029795 GCAGATGCCATTCGCAGAATT pLKO.1 867 3UTR 100% 0.000 0.000 N DNAJC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08269 pDONR223 100% 16.2% None (many diffs) n/a
2 ccsbBroad304_08269 pLX_304 0% 16.2% V5 (many diffs) n/a
3 TRCN0000474594 TCCGTGGTCTGCCCAGGTTGACGG pLX_317 49.4% 16.2% V5 (many diffs) n/a
Download CSV