Transcript: Mouse XM_006515052.3

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member C27 (Dnajc27), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajc27 (217378)
Length:
4791
CDS:
218..1114

Additional Resources:

NCBI RefSeq record:
XM_006515052.3
NBCI Gene record:
Dnajc27 (217378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329569 AGCGGCTTCCTGGTTAGTATT pLKO_005 1517 3UTR 100% 13.200 18.480 N Dnajc27 n/a
2 TRCN0000329567 ACACCGCTGCATCGATGAAAG pLKO_005 712 CDS 100% 10.800 15.120 N Dnajc27 n/a
3 TRCN0000102824 CACGGGAACATGGACAACATT pLKO.1 578 CDS 100% 5.625 7.875 N Dnajc27 n/a
4 TRCN0000102821 CCTTCTTCTTTGAGGTCCGAA pLKO.1 444 CDS 100% 2.640 3.696 N Dnajc27 n/a
5 TRCN0000329570 TATTCGCAGAATCCGAAATAG pLKO_005 916 CDS 100% 13.200 9.240 N Dnajc27 n/a
6 TRCN0000329571 ACGGGAACATGGACAACATTG pLKO_005 579 CDS 100% 10.800 7.560 N Dnajc27 n/a
7 TRCN0000102823 CCATAGTTGACTTGTGTGAAA pLKO.1 834 CDS 100% 4.950 3.465 N Dnajc27 n/a
8 TRCN0000029797 GCCTTCAAAGCAGTTGTGAAT pLKO.1 1061 CDS 100% 4.950 3.465 N DNAJC27 n/a
9 TRCN0000102822 GCGCTACTGTGAGAAGAGATT pLKO.1 319 CDS 100% 4.950 3.465 N Dnajc27 n/a
10 TRCN0000102820 GCTTGTATTTACCTCAGGAAA pLKO.1 3892 3UTR 100% 4.950 3.465 N Dnajc27 n/a
11 TRCN0000329638 CAACCATCGGGATTGACTATG pLKO_005 357 CDS 100% 10.800 6.480 N Dnajc27 n/a
12 TRCN0000029796 GCTGGACATCCCTTCTTCTAT pLKO.1 434 CDS 100% 5.625 3.938 N DNAJC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08269 pDONR223 100% 82.2% 85.5% None (many diffs) n/a
2 ccsbBroad304_08269 pLX_304 0% 82.2% 85.5% V5 (many diffs) n/a
3 TRCN0000474594 TCCGTGGTCTGCCCAGGTTGACGG pLX_317 49.4% 82.2% 85.5% V5 (many diffs) n/a
Download CSV