Construct: ORF TRCN0000474643
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002181.1_s317c1
- Derived from:
- ccsbBroadEn_01298
- DNA Barcode:
- CACTTTTGCAGGAATGATATTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRPS2 (5634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474643
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5634 | PRPS2 | phosphoribosyl pyrophosphat... | NM_001039091.2 | 100% | 100% | |
| 2 | human | 5634 | PRPS2 | phosphoribosyl pyrophosphat... | NM_002765.4 | 99% | 99% | 304_305insAGGTAGGAG |
| 3 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_002764.4 | 79.1% | 94.3% | (many diffs) |
| 4 | human | 221823 | PRPS1L1 | phosphoribosyl pyrophosphat... | NM_175886.3 | 78.5% | 90% | (many diffs) |
| 5 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_001204402.1 | 28.6% | 34.5% | (many diffs) |
| 6 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | NM_001313758.1 | 89% | 98.7% | (many diffs) |
| 7 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | NM_026662.5 | 88.2% | 97.8% | (many diffs) |
| 8 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | XM_017318351.1 | 37.3% | 24.1% | (many diffs) |
| 9 | mouse | 110639 | Prps2 | phosphoribosyl pyrophosphat... | XM_017318352.1 | 36.7% | 23.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1032
- ORF length:
- 963
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccaacatc gtgctgttca gcggcagctc gcatcaggac ctgtcccagc 121 gcgtggccga ccgcctgggc ctggagctgg gcaaggtggt cacgaagaag ttcagcaacc 181 aggagaccag cgtggagatt ggtgaaagcg tgagagggga agatgtctac atcatccaga 241 gcggctgcgg ggaaattaac gacaacctga tggaactcct catcatgatc aatgcctgca 301 agattgcgtc atcatccaga gtaactgccg tgatcccgtg tttcccatac gcccgacaag 361 ataaaaagga caaggtagga gagagtcgtg ccccaatttc tgcaaaactt gtggccaata 421 tgctgtcggt ggctggggcg gatcacatca tcaccatgga cctgcatgct tctcagatac 481 agggattctt tgatattcct gtggataatt tgtatgcgga gcccgcagtc ctgcagtgga 541 ttcgggaaaa cattgccgag tggaagaact gtatcattgt ttcacctgac gcagggggag 601 ccaaaagggt tacatcaatt gcagacaggt tgaatgtgga atttgctttg atccacaaag 661 agaggaagaa ggcgaatgaa gtggaccgga tggTCCTGGT GGGCGACGTG AAGGACCGTG 721 TGGCCATCCT CGTGGATGAC ATGGCTGACA CTTGCGGCAC CATCTGCCAT GCTGCGGACA 781 AGCTGCTGTC AGCTGGAGCC ACCAAAGTGT ATGCTATCCT TACCCATGGG ATCTTCTCTG 841 GACCAGCTAT TTCCAGAATA AATAATGCCG CCTTTGAGGC TGTTGTCGTC ACAAACACAA 901 TTCCGCAAGA GGACAAAATG AAACACTGCA CCAAGATTCA GGTCATTGAC ATTTCCATGA 961 TCTTGGCCGA AGCAATCCGA AGGACACACA ATGGGGAATC CGTGTCCTAC CTGTTCAGCC 1021 ATGTCCCGCT ATTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACAC TTTTGCAGGA ATGATATTAT 1201 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t