Transcript: Mouse XM_017318352.1

PREDICTED: Mus musculus phosphoribosyl pyrophosphate synthetase 2 (Prps2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prps2 (110639)
Length:
1057
CDS:
272..1042

Additional Resources:

NCBI RefSeq record:
XM_017318352.1
NBCI Gene record:
Prps2 (110639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276707 CAGTGTCGAGATCGGTGAAAG pLKO_005 634 CDS 100% 10.800 15.120 N Prps2 n/a
2 TRCN0000025540 CGTGCAAGATTGCGTCCTCAT pLKO.1 741 CDS 100% 4.050 5.670 N Prps2 n/a
3 TRCN0000285618 CGTGCAAGATTGCGTCCTCAT pLKO_005 741 CDS 100% 4.050 5.670 N Prps2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01299 pDONR223 100% 36.9% 23.6% None (many diffs) n/a
2 ccsbBroad304_01299 pLX_304 0% 36.9% 23.6% V5 (many diffs) n/a
3 TRCN0000475829 AATCCTTTTAGAGGCTTGGACTGC pLX_317 32% 36.9% 23.6% V5 (many diffs) n/a
4 ccsbBroadEn_06782 pDONR223 100% 36.8% 23.6% None (many diffs) n/a
5 TRCN0000466127 ACTCAGTGCCGCACGCAGTATTGT pLX_317 40.1% 36.8% 23.6% V5 (many diffs) n/a
6 ccsbBroadEn_14816 pDONR223 0% 36.8% 23.6% None (many diffs) n/a
7 ccsbBroad304_14816 pLX_304 0% 36.8% 23.6% V5 (many diffs) n/a
8 TRCN0000471920 CGTGGCCTACGACTTCCGGATCCG pLX_317 35.5% 36.8% 23.6% V5 (many diffs) n/a
9 TRCN0000492233 GTTTTTGGCATTCGTGCCCAATAT pLX_317 43.2% 36.8% 23.6% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_01298 pDONR223 100% 36.7% 23.6% None (many diffs) n/a
11 ccsbBroad304_01298 pLX_304 0% 36.7% 23.6% V5 (many diffs) n/a
12 TRCN0000474643 CACTTTTGCAGGAATGATATTATT pLX_317 35.3% 36.7% 23.6% V5 (many diffs) n/a
Download CSV