Construct: ORF TRCN0000474710
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000483.4_s317c1
- Derived from:
- ccsbBroadEn_14527
- DNA Barcode:
- GATATTCCTACCTCCATACTATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACVR1 (90)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474710
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001105.5 | 99.8% | 100% | 270C>T;690G>A |
| 2 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001111067.4 | 99.8% | 100% | 270C>T;690G>A |
| 3 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001347663.1 | 99.8% | 100% | 270C>T;690G>A |
| 4 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001347664.1 | 99.8% | 100% | 270C>T;690G>A |
| 5 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001347665.1 | 99.8% | 100% | 270C>T;690G>A |
| 6 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001347666.1 | 99.8% | 100% | 270C>T;690G>A |
| 7 | human | 90 | ACVR1 | activin A receptor type 1 | NM_001347667.2 | 99.8% | 100% | 270C>T;690G>A |
| 8 | human | 90 | ACVR1 | activin A receptor type 1 | XM_006712825.4 | 99.8% | 100% | 270C>T;690G>A |
| 9 | human | 90 | ACVR1 | activin A receptor type 1 | XM_011512108.3 | 99.8% | 100% | 270C>T;690G>A |
| 10 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | NM_001110204.1 | 90.7% | 98.4% | (many diffs) |
| 11 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | NM_001110205.1 | 90.7% | 98.4% | (many diffs) |
| 12 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | NM_007394.3 | 90.7% | 98.4% | (many diffs) |
| 13 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | XM_006497622.3 | 90.7% | 98.4% | (many diffs) |
| 14 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | XM_017315005.1 | 90.7% | 98.4% | (many diffs) |
| 15 | mouse | 11477 | Acvr1 | activin A receptor, type 1 | XM_017315006.1 | 90.7% | 98.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1593
- ORF length:
- 1527
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt agatggagtg atgattcttc ctgtgcttat catgattgct ctcccctccc 121 ctagtatgga agatgagaag cccaaggtca accccaaact ctacatgtgt gtgtgtgaag 181 gtctctcctg cggtaatgag gaccactgtg aaggccagca gtgcttttcc tcactgagca 241 tcaacgatgg cttccacgtc taccagaaag gctgcttcca ggtttatgag cagggaaaga 301 tgacctgtaa gaccccgccg tcccctggcc aagctgtgga gtgctgccaa ggggactggt 361 gtaacaggaa catcacggcc cagctgccca ctaaaggaaa atccttccct ggaacacaga 421 atttccactt ggaggttggc ctcattattc tctctgtagt gttcgcagta tgtcttttag 481 cctgcctgct gggagttgct ctccgaaaat ttaaaaggcg caaccaagaa cgcctcaatc 541 cccgagacgt ggagtatggc actatcgaag ggctcatcac caccaatgtt ggagacagca 601 ctttagcaga tttattggat cattcgtgta catcaggaag tggctctggt cttccttttc 661 tggtacaaag aacagtggct cgccagatta cactgttgga gtgtgtcggg aaaggcaggt 721 atggtgaggt gtggaggggc agctggcaag gggaaaatgt tgccgtgaag atcttctcct 781 cccgtgatga gaagtcatgg ttcagggaaa cggaattgta caacactgtg atgctgaggc 841 atgaaaatat cttaggtttc attgcttcag acatgacatc aagacactcc agtacccagc 901 tgtggttaat tacacattat catgaaatgg gatcgttgta cgactatctt cagcttacta 961 ctctggatac agttagctgc cttcgaatag tgctgtccat agctagtggt cttgcacatt 1021 tgcacataga gatatttggg acccaaggga aaccagccat tgcccatcga gatttaaaga 1081 gcaaaaatat tctggttaag aagaatggac agtgttgcat agcagatttg ggccTGGCAG 1141 TCATGCATTC CCAGAGCACC AATCAGCTTG ATGTGGGGAA CAATCCCCGT GTGGGCACCA 1201 AGCGCTACAT GGCCCCCGAA GTTCTAGATG AAACCATCCA GGTGGATTGT TTCGATTCTT 1261 ATAAAAGGGT CGATATTTGG GCCTTTGGAC TTGTTTTGTG GGAAGTGGCC AGGCGGATGG 1321 TGAGCAATGG TATAGTGGAG GATTACAAGC CACCGTTCTA CGATGTGGTT CCCAATGACC 1381 CAAGTTTTGA AGATATGAGG AAGGTAGTCT GTGTGGATCA ACAAAGGCCA AACATACCCA 1441 ACAGATGGTT CTCAGACCCG ACATTAACCT CTCTGGCCAA GCTAATGAAA GAATGCTGGT 1501 ATCAAAATCC ATCCGCAAGA CTCACAGCAC TGCGTATCAA AAAGACTTTG ACCAAAATTG 1561 ATAATTCCCT CGACAAATTG AAAACTGACT GTTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1621 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1681 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA 1741 TATTCCTACC TCCATACTAT TGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1801 ttgtgaaaga tt