Transcript: Human NM_001347666.1

Homo sapiens activin A receptor type 1 (ACVR1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ACVR1 (90)
Length:
3011
CDS:
397..1926

Additional Resources:

NCBI RefSeq record:
NM_001347666.1
NBCI Gene record:
ACVR1 (90)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382239 TGATAATTCCCTCGACAAATT pLKO_005 1890 CDS 100% 13.200 18.480 N ACVR1 n/a
2 TRCN0000000441 GCAGAACGTATTTAGCCATTA pLKO.1 2779 3UTR 100% 10.800 15.120 N ACVR1 n/a
3 TRCN0000000442 CGGATGGTGAGCAATGGTATA pLKO.1 1645 CDS 100% 10.800 8.640 N ACVR1 n/a
4 TRCN0000315051 CGGATGGTGAGCAATGGTATA pLKO_005 1645 CDS 100% 10.800 8.640 N ACVR1 n/a
5 TRCN0000195081 CTGGTCTGTCTTTGGATAATA pLKO.1 2434 3UTR 100% 15.000 10.500 N ACVR1 n/a
6 TRCN0000194668 CTTGCACTGTTACTCTTAATT pLKO.1 2373 3UTR 100% 15.000 10.500 N ACVR1 n/a
7 TRCN0000195486 CTTGGAGGTTGGCCTCATTAT pLKO.1 759 CDS 100% 13.200 9.240 N ACVR1 n/a
8 TRCN0000000443 GACAGCACTTTAGCAGATTTA pLKO.1 925 CDS 100% 13.200 9.240 N ACVR1 n/a
9 TRCN0000315118 GACAGCACTTTAGCAGATTTA pLKO_005 925 CDS 100% 13.200 9.240 N ACVR1 n/a
10 TRCN0000000445 GTGGATTGTTTCGATTCTTAT pLKO.1 1573 CDS 100% 13.200 9.240 N ACVR1 n/a
11 TRCN0000315050 GTGGATTGTTTCGATTCTTAT pLKO_005 1573 CDS 100% 13.200 9.240 N ACVR1 n/a
12 TRCN0000321754 TGGTTCTCAGACCCGACATTA pLKO_005 1777 CDS 100% 13.200 9.240 N Acvr1 n/a
13 TRCN0000321822 TTGTCCAGCTGGGACCTAATG pLKO_005 1969 3UTR 100% 10.800 7.560 N Acvr1 n/a
14 TRCN0000000444 CTAATGAAAGAATGCTGGTAT pLKO.1 1813 CDS 100% 4.950 3.465 N ACVR1 n/a
15 TRCN0000199872 GCCTGACTGGTTGTCAGAATG pLKO.1 1993 3UTR 100% 1.080 0.756 N ACVR1 n/a
16 TRCN0000315052 GCCTGACTGGTTGTCAGAATG pLKO_005 1993 3UTR 100% 1.080 0.756 N ACVR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05767 pDONR223 100% 99.8% 100% None 270C>T;690G>A n/a
2 ccsbBroad304_05767 pLX_304 0% 99.8% 100% V5 270C>T;690G>A n/a
3 TRCN0000469327 ACCAAAGGCGGGTTTGGTAGCTTC pLX_317 27.6% 99.8% 100% V5 270C>T;690G>A n/a
4 ccsbBroadEn_14527 pDONR223 0% 99.8% 100% None 270C>T;690G>A n/a
5 ccsbBroad304_14527 pLX_304 0% 99.8% 100% V5 270C>T;690G>A n/a
6 TRCN0000474710 GATATTCCTACCTCCATACTATTG pLX_317 30.3% 99.8% 100% V5 270C>T;690G>A n/a
Download CSV