Transcript: Human XM_024449884.1

PREDICTED: Homo sapiens GA binding protein transcription factor subunit beta 1 (GABPB1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABPB1 (2553)
Length:
6940
CDS:
4366..5565

Additional Resources:

NCBI RefSeq record:
XM_024449884.1
NBCI Gene record:
GABPB1 (2553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245028 GAATTGGTCAGCCCATCATTG pLKO_005 5252 CDS 100% 10.800 15.120 N GABPB1 n/a
2 TRCN0000019137 GCAACAGATGAAACGGGTGTA pLKO.1 4993 CDS 100% 4.050 5.670 N GABPB1 n/a
3 TRCN0000245031 AGAGACAATGTATCGAAATAA pLKO_005 5360 CDS 100% 15.000 10.500 N GABPB1 n/a
4 TRCN0000245030 TTGCTGAAGAAACTGTTATAA pLKO_005 5321 CDS 100% 15.000 10.500 N GABPB1 n/a
5 TRCN0000019138 CCAGATGGACAACAAGTATTA pLKO.1 5281 CDS 100% 13.200 9.240 N GABPB1 n/a
6 TRCN0000245029 CCAGATGGACAACAAGTATTA pLKO_005 5281 CDS 100% 13.200 9.240 N GABPB1 n/a
7 TRCN0000425216 AGCATGGTGCTGATGTCAATG pLKO_005 4655 CDS 100% 10.800 7.560 N Cdkn2d n/a
8 TRCN0000245027 CAAGATGATGAAGTTCGTATT pLKO_005 4432 CDS 100% 10.800 7.560 N GABPB1 n/a
9 TRCN0000218841 GATTGCTATGCAGAACCAAAT pLKO_005 4851 CDS 100% 10.800 7.560 N Gabpb1 n/a
10 TRCN0000085341 GCAACAGACATTGCTGAAGAA pLKO.1 5311 CDS 100% 4.950 3.465 N Gabpb1 n/a
11 TRCN0000019134 GCAGAACCAAATCAACACAAA pLKO.1 4860 CDS 100% 4.950 3.465 N GABPB1 n/a
12 TRCN0000019136 GCTTGGAAATTTGCACTCTAT pLKO.1 5220 CDS 100% 4.950 3.465 N GABPB1 n/a
13 TRCN0000019135 GCCACAGAACACAATCATCAA pLKO.1 4711 CDS 100% 4.950 2.970 N GABPB1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1251 5UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1251 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00606 pDONR223 100% 98.5% 98.5% None 1_15del;746_747insAGT n/a
2 ccsbBroad304_00606 pLX_304 0% 98.5% 98.5% V5 1_15del;746_747insAGT n/a
3 TRCN0000472520 CGGAACTTGGCTGGCCAAACCGAT pLX_317 37.9% 98.5% 98.5% V5 1_15del;746_747insAGT n/a
4 ccsbBroadEn_15421 pDONR223 0% 95.4% 95.2% None (many diffs) n/a
5 ccsbBroad304_15421 pLX_304 0% 95.4% 95.2% V5 (many diffs) n/a
6 TRCN0000474730 CCGTCAGAAGAAGATAGTACCATA pLX_317 43.5% 95.4% 95.2% V5 (many diffs) n/a
7 ccsbBroadEn_15422 pDONR223 0% 87.8% 86.7% None (many diffs) n/a
8 ccsbBroad304_15422 pLX_304 0% 87.8% 86.7% V5 (many diffs) n/a
9 TRCN0000470558 GCAGAACGATTTCGCCTGCAAACG pLX_317 33.8% 87.8% 86.7% V5 (many diffs) n/a
Download CSV