Construct: ORF TRCN0000474826
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013473.1_s317c1
- Derived from:
- ccsbBroadEn_11292
- DNA Barcode:
- GACTGGCGCTTGCTACGCGTTACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUMB (8650)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474826
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8650 | NUMB | NUMB endocytic adaptor protein | NM_001005745.1 | 39% | 36.1% | (many diffs) |
| 2 | human | 8650 | NUMB | NUMB endocytic adaptor protein | NM_001005744.1 | 38.3% | 35.4% | (many diffs) |
| 3 | human | 8650 | NUMB | NUMB endocytic adaptor protein | NM_001320114.1 | 38.3% | 35.4% | (many diffs) |
| 4 | human | 8650 | NUMB | NUMB endocytic adaptor protein | NM_003744.5 | 36.1% | 33.4% | (many diffs) |
| 5 | human | 8650 | NUMB | NUMB endocytic adaptor protein | NM_001005743.1 | 35.5% | 32.8% | (many diffs) |
| 6 | mouse | 18222 | Numb | numb homolog (Drosophila) | NM_001272056.1 | 35.7% | 36.1% | (many diffs) |
| 7 | mouse | 18222 | Numb | numb homolog (Drosophila) | NM_010949.2 | 35.1% | 35.4% | (many diffs) |
| 8 | mouse | 18222 | Numb | numb homolog (Drosophila) | NM_001272055.1 | 33% | 33.3% | (many diffs) |
| 9 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515578.1 | 33% | 33.3% | (many diffs) |
| 10 | mouse | 18222 | Numb | numb homolog (Drosophila) | NM_001136075.2 | 32.4% | 32.8% | (many diffs) |
| 11 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515576.1 | 32.4% | 32.8% | (many diffs) |
| 12 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515577.2 | 32.4% | 32.8% | (many diffs) |
| 13 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_011244012.2 | 32.4% | 32.8% | (many diffs) |
| 14 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515575.2 | 31.2% | 31.5% | (many diffs) |
| 15 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515574.2 | 30.7% | 31% | (many diffs) |
| 16 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515573.2 | 29.1% | 29.4% | (many diffs) |
| 17 | mouse | 18222 | Numb | numb homolog (Drosophila) | XM_006515572.2 | 28.6% | 28.9% | (many diffs) |
| 18 | mouse | 18222 | Numb | numb homolog (Drosophila) | NR_073563.1 | 17.9% | (many diffs) | |
| 19 | mouse | 18222 | Numb | numb homolog (Drosophila) | NR_073564.1 | 17.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caaattacgg caaagtttta ggagaaagaa ggatgtttat gttccagagg 121 ccagtcgtcc acatcagtgg cagacagatg aagaaggcgt tcgcaccgga aaatgtagct 181 tcccggttaa gtaccttggc catgtagaag ttgatgaatc aagaggaatg cacatctgtg 241 aagatgctgt aaaaagattg aaagctactg gaaagaaagc agttaaagca gttctgtggg 301 tctcagcaga tggactcaga gttgtggatg aaaaaactaa ggacctcata gttgaccaga 361 cgatagagaa agtttctttc tgtgccccag acaggaactt TGATAGAGCC TTTTCTTACA 421 TATGCCGTGA TGGCACCACT CGTCGCTGGA TCTGTCACTG CTTCATGGCT GTCAAGGACA 481 CAGGTGAAAG GTTGAGCCAT GCAGTAGGCT GTGCTTTTGC AGCCTGTTTA GAGCGCAAGC 541 AGAAGCGGGA GAAGGAATGT GGAGTGACTG CTACTTTTGA TGCTAGTCGG ACCACTTTTA 601 CAAGAGAAGG ATCATTCCGT GTCACAACAG CCACTGAACA AGCAGAAAGA GAGGAGATCA 661 TGAAACAAAT GCAAGATGCC AAGAAAGGTA CAATCTGTTC TACAGTGTGT ATTTATGGAA 721 TGCAGTTTTT CCCAACAAGG TATTATTTTG AAGCTACCAG GGGTAAATTT TCTCATAATC 781 AAAGAGAACC CTTAGCAATA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 841 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 901 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGACT GGCGCTTGCT 961 ACGCGTTACG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt