Transcript: Mouse XM_006515572.2

PREDICTED: Mus musculus numb homolog (Drosophila) (Numb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Numb (18222)
Length:
3627
CDS:
2..2224

Additional Resources:

NCBI RefSeq record:
XM_006515572.2
NBCI Gene record:
Numb (18222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105735 GCAGCCTGTTTAGAGCGTAAA pLKO.1 749 CDS 100% 10.800 15.120 N Numb n/a
2 TRCN0000327233 GCAGCCTGTTTAGAGCGTAAA pLKO_005 749 CDS 100% 10.800 15.120 N Numb n/a
3 TRCN0000105736 GCTGGTTAGAAGAAGTGTCAA pLKO.1 1593 CDS 100% 4.950 3.960 N Numb n/a
4 TRCN0000327309 GCTGGTTAGAAGAAGTGTCAA pLKO_005 1593 CDS 100% 4.950 3.960 N Numb n/a
5 TRCN0000105739 CAGCAGACATTCCCTCAATAT pLKO.1 1943 CDS 100% 13.200 9.240 N Numb n/a
6 TRCN0000363599 CAGCAGACATTCCCTCAATAT pLKO_005 1943 CDS 100% 13.200 9.240 N Numb n/a
7 TRCN0000105738 GCCAGAAGATGTCACCCTTTA pLKO.1 1113 CDS 100% 10.800 7.560 N Numb n/a
8 TRCN0000327236 GCCAGAAGATGTCACCCTTTA pLKO_005 1113 CDS 100% 10.800 7.560 N Numb n/a
9 TRCN0000105737 GCGATGGATCTGTCATTGTTT pLKO.1 673 CDS 100% 5.625 3.938 N Numb n/a
10 TRCN0000327235 GCGATGGATCTGTCATTGTTT pLKO_005 673 CDS 100% 5.625 3.938 N Numb n/a
11 TRCN0000007225 GCAGCTTTCAATGGTGTAGAT pLKO.1 2027 CDS 100% 4.950 6.930 N NUMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489234 AACTCGAACCGCAACTACAAGGAA pLX_317 18.8% 78.8% 82.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489619 AATGGCTCTCTTGTCCGGCATGCA pLX_317 19.6% 74% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491413 CTGCATACTTAGTCTAAACTTGTC pLX_317 12.9% 71.4% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11292 pDONR223 100% 28.6% 28.9% None (many diffs) n/a
5 ccsbBroad304_11292 pLX_304 0% 28.6% 28.9% V5 (many diffs) n/a
6 TRCN0000474826 GACTGGCGCTTGCTACGCGTTACG pLX_317 54.4% 28.6% 28.9% V5 (many diffs) n/a
7 ccsbBroadEn_11291 pDONR223 100% 16.1% 16.3% None (many diffs) n/a
8 ccsbBroad304_11291 pLX_304 0% 16.1% 16.3% V5 (many diffs) n/a
9 TRCN0000466523 ATTTCTTGGATTTTTATCGGCCAC pLX_317 93.8% 16.1% 16.3% V5 (many diffs) n/a
Download CSV