Transcript: Human NM_001005744.1

Homo sapiens NUMB endocytic adaptor protein (NUMB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NUMB (8650)
Length:
3503
CDS:
321..2132

Additional Resources:

NCBI RefSeq record:
NM_001005744.1
NBCI Gene record:
NUMB (8650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007223 CCTTGCAATTAGGCTAAAGAA pLKO.1 2331 3UTR 100% 5.625 7.875 N NUMB n/a
2 TRCN0000430626 GACGTTTGAAATTGAACTTTA pLKO_005 2111 CDS 100% 13.200 10.560 N NUMB n/a
3 TRCN0000007227 GCATCACCTTTCCAAGGGAAT pLKO.1 1611 CDS 100% 4.050 3.240 N NUMB n/a
4 TRCN0000420785 CAGATGGTGGCCAACGTATTT pLKO_005 1773 CDS 100% 13.200 9.240 N NUMB n/a
5 TRCN0000430008 ACCCTTTAAACGCCAACTATC pLKO_005 1184 CDS 100% 10.800 7.560 N NUMB n/a
6 TRCN0000105738 GCCAGAAGATGTCACCCTTTA pLKO.1 1171 CDS 100% 10.800 7.560 N Numb n/a
7 TRCN0000327236 GCCAGAAGATGTCACCCTTTA pLKO_005 1171 CDS 100% 10.800 7.560 N Numb n/a
8 TRCN0000007224 GCAATCATTATGGCTATGTAT pLKO.1 2133 CDS 100% 5.625 3.938 N NUMB n/a
9 TRCN0000007225 GCAGCTTTCAATGGTGTAGAT pLKO.1 1935 CDS 100% 4.950 3.465 N NUMB n/a
10 TRCN0000007226 GCCATGTAGAAGTTGATGAAT pLKO.1 454 CDS 100% 5.625 3.375 N NUMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491413 CTGCATACTTAGTCTAAACTTGTC pLX_317 12.9% 98.1% 98.1% V5 (not translated due to prior stop codon) 202_234del n/a
2 TRCN0000489619 AATGGCTCTCTTGTCCGGCATGCA pLX_317 19.6% 93.1% V5 (not translated due to prior stop codon) 0_1ins96;202_234del;1809_1810insG n/a
3 TRCN0000489234 AACTCGAACCGCAACTACAAGGAA pLX_317 18.8% 92.6% 92.6% V5 (not translated due to prior stop codon) 1095_1096ins144 n/a
4 ccsbBroadEn_11292 pDONR223 100% 38.3% 35.4% None (many diffs) n/a
5 ccsbBroad304_11292 pLX_304 0% 38.3% 35.4% V5 (many diffs) n/a
6 TRCN0000474826 GACTGGCGCTTGCTACGCGTTACG pLX_317 54.4% 38.3% 35.4% V5 (many diffs) n/a
7 ccsbBroadEn_11291 pDONR223 100% 22.3% 22.3% None 1_1404del n/a
8 ccsbBroad304_11291 pLX_304 0% 22.3% 22.3% V5 1_1404del n/a
9 TRCN0000466523 ATTTCTTGGATTTTTATCGGCCAC pLX_317 93.8% 22.3% 22.3% V5 1_1404del n/a
Download CSV