Construct: ORF TRCN0000474901
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017403.1_s317c1
- Derived from:
- ccsbBroadEn_07727
- DNA Barcode:
- CTTTTTATTAACAATCCGAAGTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIAS (11019)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474901
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11019 | LIAS | lipoic acid synthetase | NM_006859.4 | 99.9% | 99.7% | 758C>T |
2 | human | 11019 | LIAS | lipoic acid synthetase | NM_001278590.2 | 88.3% | 88.1% | 606_607ins129;629C>T |
3 | human | 11019 | LIAS | lipoic acid synthetase | NM_194451.3 | 86.2% | 85.4% | (many diffs) |
4 | human | 11019 | LIAS | lipoic acid synthetase | NM_001363700.2 | 72.2% | 67% | 218_219ins94;298_299ins215;449C>T |
5 | human | 11019 | LIAS | lipoic acid synthetase | NM_001278591.1 | 37.1% | 36% | (many diffs) |
6 | human | 11019 | LIAS | lipoic acid synthetase | NM_001278592.1 | 26.7% | 19.3% | 218_219ins94;300_300delGins723 |
7 | mouse | 79464 | Lias | lipoic acid synthetase | NM_024471.5 | 86.4% | 89.5% | (many diffs) |
8 | mouse | 79464 | Lias | lipoic acid synthetase | NM_001310612.1 | 66.8% | 70.8% | (many diffs) |
9 | mouse | 79464 | Lias | lipoic acid synthetase | XM_006504195.2 | 23.2% | 17% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1182
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tctacgctgc ggggatgcag cccgcaccct ggggccccgg gtatttggga 121 gatatttttg cagcccagtc agaccgttaa gctccttgcc agataaaaaa aaggaactcc 181 tacagaatgg accagacctt caagattttg tatctggtga tcttgcagac aggagcacct 241 gggatgaata taaaggaaac ctaaaacgcc agaaaggaga aaggttaaga ctacctccat 301 ggctaaagac agagattccc atggggaaaa attacaataa actgaaaaat actttgcgga 361 atttaaatct ccatacagta tgtgaggaag ctcgatgtcc caatattgga gagtgttggg 421 gaggtggaga atatgccacc gccacagcca cgatcatgtt gatgggtgac acatgtacaa 481 gaggttgcag attttgttct gttaagactg caagaaatcc tcctccactg gatgccagtg 541 agccctacaa tactgcaaag gcaattgcag aatggggtct ggattatgtt gtcctgacat 601 ctgtggatcg agatgatatg cctgatgggg gagctgaaca cattgcaaag accgtatcat 661 atttaaagga aaggaatcca aaaatccttg tggagtgtct tactcctGAT TTTCGAGGTG 721 ATCTCAAAGC AATAGAAAAA GTTGCTCTGT CAGGATTAGA TGTGTATGCA CATAATGTAG 781 AAACAGTCCC GGAATTACAG AGTAAGGTTC GTGATCCTCG GGTCAATTTT GATCAGTCCC 841 TACGTGTACT GAAACATGCC AAGAAGGTTC AGCCTGATGT TATTTCTAAA ACATCTATAA 901 TGTTGGGTTT AGGCGAGAAT GATGAGCAAG TATATGCAAC AATGAAAGCA CTTCGTGAGG 961 CAGATGTAGA CTGCTTGACT TTAGGACAAT ATATGCAGCC AACAAGGCGT CACCTTAAGG 1021 TTGAAGAATA TATTACTCCT GAAAAATTCA AATACTGGGA AAAAGTAGGA AATGAACTTG 1081 GATTTCATTA TACTGCAAGT GGCCCTTTGG TGCGTTCTTC ATATAAAGCA GGTGAATTTT 1141 TCCTGAAAAA TCTAGTGGCT AAAAGAAAAA CAAAAGACCT CTACCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGACTT TTTATTAACA ATCCGAAGTA AACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t