Transcript: Human NM_001278592.1

Homo sapiens lipoic acid synthetase (LIAS), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
LIAS (11019)
Length:
610
CDS:
95..397

Additional Resources:

NCBI RefSeq record:
NM_001278592.1
NBCI Gene record:
LIAS (11019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229750 CCGGGTATTTGGGAGATATTT pLKO_005 136 CDS 100% 15.000 21.000 N LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11581 pDONR223 100% 70.4% 46.6% None 218_219ins94;300_301ins32 n/a
2 ccsbBroad304_11581 pLX_304 0% 70.4% 46.6% V5 218_219ins94;300_301ins32 n/a
3 TRCN0000478462 GCAATGTCTACGCCGATCTTTCAA pLX_317 93.9% 70.4% 46.6% V5 218_219ins94;300_301ins32 n/a
4 ccsbBroadEn_07727 pDONR223 100% 26.7% 19.3% None 218_219ins94;300_300delGins723 n/a
5 ccsbBroad304_07727 pLX_304 0% 26.7% 19.3% V5 218_219ins94;300_300delGins723 n/a
6 TRCN0000474901 CTTTTTATTAACAATCCGAAGTAA pLX_317 42.6% 26.7% 19.3% V5 218_219ins94;300_300delGins723 n/a
Download CSV