Construct: ORF TRCN0000475010
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007695.1_s317c1
- Derived from:
- ccsbBroadEn_09288
- DNA Barcode:
- TCTTTAGGCCTCTTCACTATATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HS6ST2 (90161)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475010
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | NM_147175.4 | 99.9% | 100% | 9G>T |
2 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_005262491.3 | 98.1% | 98.2% | 9G>T;946_978del |
3 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | NM_001077188.2 | 93.7% | 93.7% | 9G>T;948_1067del |
4 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_017029946.1 | 74.5% | 74.5% | 0_1ins438;508_540del |
5 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_011531406.1 | 71.1% | 71.1% | 0_1ins438;510_629del |
6 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_017029945.1 | 71.1% | 71.1% | 0_1ins438;510_629del |
7 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_011531407.3 | 54.5% | 52.1% | (many diffs) |
8 | human | 90161 | HS6ST2 | heparan sulfate 6-O-sulfotr... | XM_011531408.3 | 53.7% | 52.2% | (many diffs) |
9 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | NM_001290467.1 | 90.5% | 91.5% | (many diffs) |
10 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | XM_006541516.3 | 86.4% | 87.2% | (many diffs) |
11 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | NM_001077202.2 | 84.9% | 85.8% | (many diffs) |
12 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | NM_015819.4 | 68.7% | 71.2% | (many diffs) |
13 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | NM_001290468.1 | 64.5% | 66.8% | (many diffs) |
14 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | XM_006541518.2 | 64.5% | 66.8% | (many diffs) |
15 | mouse | 50786 | Hs6st2 | heparan sulfate 6-O-sulfotr... | XM_006541519.3 | 64.5% | 66.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1884
- ORF length:
- 1815
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcacttcct gcgtgtgcag tccgggagtt cgagccgccg cggcaaccgg 121 agcgaggagc gcccgtccgc accacctgtc cccgccggca ttccagagta gaggccgaat 181 tggcagcgag ccggcccggg tcggtcgccg cctcagttcg cgcgggccct cctaggggtg 241 tgtctcacgg attccacacc cggccgctcc tggacaagcc ccgaaaggcg tcttcttccc 301 tggcgggagc cgcgtgcgcc ccgcttttcg cgctgctgtc ccggggccgc cgcaggcgga 361 tgcacgtcct caggcgacgc tgggacctgg gctccctctg ccgggccctg ctcactcggg 421 gcctggccgc cctgggccac tcgctgaagc acgtgctcgg tgcgatcttc tccaagattt 481 tcggccccat ggccagcgtc gggaacatgg atgagaaatc caacaagctg ctgctagctt 541 tggtgatgct cttcctattt gccgtgatcg tcctccaata cgtgtgcccc ggcacagaat 601 gccagctcct ccgcctgcag gcgttcagct ccccggtgcc ggacccgtac cgctcggagg 661 atgagagctc cgccaggttc gtgccccgct acaatttcac ccgcggcgac ctcctgcgca 721 aggtagactt cgacatcaag ggcgatgacc tgatcgtgtt cctgcacatc cagaagaccg 781 ggggcaccac tttcggccgc cacttggtgc gtaacatcca gctggagcag ccgtgcgagt 841 gccgcgtggg tcagaagaaa tgcacttgcc accggccggg taagcgggaa acctggctct 901 tctccaggtt ctccacgggc tggagctgcg ggttgcacgc cgactggacc gagctcacca 961 gctgtgtgcc ctccgtggtg gacggcaagc gcgacgccag gctgagaccg tccaggaact 1021 tccactacat caccatcctc cgagacccag tgtcccggta cttgagtgag tggaggcatg 1081 tccagagagg ggcaacatgg aaagcatccc tgcatgtctg cgatggaagg cctccaacct 1141 ccgaagagct gcccagctgc tacactggcg atgactggtc tggctgcccc ctcaaagagt 1201 ttatggactg tccctacaat ctagccaaca accgccaggt gcgcatgctc tccgacctga 1261 ccctggtagg ctgctacaac ctctctgtca tgcctgaaaa gcaaagaaac aaggtccttc 1321 tggaaagtgc caagtcaaat ctgaagcaca tggcgttctt cggcctcact gagtttcagc 1381 ggaagaccca atatctgttt gagaaaacct tcaacatgaa ctttatttcg ccatttaccc 1441 agtataatac cactagggcc tctagtgtag agatcaatga ggaaattcaa aagcgtattg 1501 agggactgaa ttttctggat atggagttgt acagctatgc caaagacctt tttttGCAGA 1561 GGTATCAGTT TATGAGGCAG AAAGAGCATC AGGAGGCCAG GCGAAAGCGT CAGGAACAAC 1621 GCAAATTTCT GAAGGGAAGG CTCCTTCAGA CCCATTTCCA GAGCCAGGGT CAGGGCCAGA 1681 GCCAGAATCC GAATCAGAAT CAGAGTCAGA ACCCAAATCC GAATGCCAAT CAGAACCTGA 1741 CTCAGAATCT GATGCAGAAT CTGACTCAGA GTTTGAGCCA GAAGGAGAAC CGGGAAAGCC 1801 CGAAGCAGAA CTCAGGCAAG GAGCAGAATG ATAACACCAG CAATGGCACC AACGACTACA 1861 TAGGCAGTGT AGAGAAATGG CGTTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1921 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1981 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CTTTAGGCCT 2041 CTTCACTATA TCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2101 att