Transcript: Human XM_011531408.3

PREDICTED: Homo sapiens heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HS6ST2 (90161)
Length:
1985
CDS:
92..1081

Additional Resources:

NCBI RefSeq record:
XM_011531408.3
NBCI Gene record:
HS6ST2 (90161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036301 GCTTTGGTGATGCTCTTCCTA pLKO.1 560 CDS 100% 3.000 2.100 N HS6ST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09288 pDONR223 100% 53.7% 52.2% None (many diffs) n/a
2 ccsbBroad304_09288 pLX_304 0% 53.7% 52.2% V5 (many diffs) n/a
3 TRCN0000475010 TCTTTAGGCCTCTTCACTATATCT pLX_317 18.4% 53.7% 52.2% V5 (many diffs) n/a
Download CSV