Transcript: Human XM_017029946.1

PREDICTED: Homo sapiens heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HS6ST2 (90161)
Length:
3703
CDS:
80..1492

Additional Resources:

NCBI RefSeq record:
XM_017029946.1
NBCI Gene record:
HS6ST2 (90161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036303 CGTCAGGAACAACGCAAATTT pLKO.1 1214 CDS 100% 15.000 21.000 N HS6ST2 n/a
2 TRCN0000036299 GCCTCTAGTGTAGAGATCAAT pLKO.1 1064 CDS 100% 5.625 7.875 N HS6ST2 n/a
3 TRCN0000036302 GCAGAATCTGACTCAGAGTTT pLKO.1 1360 CDS 100% 4.950 3.465 N HS6ST2 n/a
4 TRCN0000036301 GCTTTGGTGATGCTCTTCCTA pLKO.1 110 CDS 100% 3.000 2.100 N HS6ST2 n/a
5 TRCN0000036300 GCAGAATGATAACACCAGCAA pLKO.1 1429 CDS 100% 2.640 1.848 N HS6ST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09288 pDONR223 100% 74.5% 74.5% None 0_1ins438;508_540del n/a
2 ccsbBroad304_09288 pLX_304 0% 74.5% 74.5% V5 0_1ins438;508_540del n/a
3 TRCN0000475010 TCTTTAGGCCTCTTCACTATATCT pLX_317 18.4% 74.5% 74.5% V5 0_1ins438;508_540del n/a
Download CSV