Construct: ORF TRCN0000475089
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005227.1_s317c1
- Derived from:
- ccsbBroadEn_02009
- DNA Barcode:
- AGTACCGCGCTGCGCACCGTGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB11A (8766)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475089
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8766 | RAB11A | RAB11A, member RAS oncogene... | NM_004663.5 | 100% | 100% | |
| 2 | human | 9230 | RAB11B | RAB11B, member RAS oncogene... | NM_004218.4 | 73% | 91.2% | (many diffs) |
| 3 | human | 8766 | RAB11A | RAB11A, member RAS oncogene... | NM_001206836.2 | 71.7% | 68% | 438_439ins95;465_466ins88 |
| 4 | mouse | 53869 | Rab11a | RAB11A, member RAS oncogene... | NM_017382.5 | 95.8% | 100% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 714
- ORF length:
- 648
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cacccgcgac gacgagtacg actacctctt taaagttgtc cttattggag 121 attctggtgt tggaaagagt aatctcctgt ctcgatttac tcgaaatgag tttaatctgg 181 aaagcaagag caccattgga gtagagtttg caacaagaag catccaggtt gatggaaaaa 241 caataaaggc acagatatgg gacacagcag ggcaagagcg atatcgagct ataacatcag 301 catattatcg tggagctgta ggtgccttat tggtttatga cattgctaaa catctcacat 361 atgaaaatgt agagcgatgg ctgaaagaac tgagagatca tgctgatagt aacattgtta 421 tcatgcttgt gggcaataag agtgatcTAC GTCATCTCAG GGCAGTTCCT ACAGATGAAG 481 CAAGAGCTTT TGCAGAAAAG AATGGTTTGT CATTCATTGA AACTTCGGCC CTAGACTCTA 541 CAAATGTAGA AGCTGCTTTT CAGACAATTT TAACAGAGAT TTACCGCATT GTTTCTCAGA 601 AGCAAATGTC AGACAGACGC GAAAATGACA TGTCTCCAAG CAACAATGTG GTTCCTATTC 661 ATGTTCCACC AACCACTGAA AACAAGCCAA AGGTGCAGTG CTGTCAGAAC ATCTACCCAA 721 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 781 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 841 TATCTTGTGG AAAGGACGAA GTACCGCGCT GCGCACCGTG ATTACGCGTT AAGTCgacaa 901 tcaacctctg gattacaaaa tttgtgaaag att