Transcript: Mouse NM_017382.5

Mus musculus RAB11A, member RAS oncogene family (Rab11a), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rab11a (53869)
Length:
2333
CDS:
134..784

Additional Resources:

NCBI RefSeq record:
NM_017382.5
NBCI Gene record:
Rab11a (53869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017382.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305864 TAACCTCCTGTCTCGATTTAC pLKO_005 208 CDS 100% 13.200 18.480 N Rab11a n/a
2 TRCN0000100344 CAGAGATATACCGCATTGTTT pLKO.1 642 CDS 100% 5.625 7.875 N Rab11a n/a
3 TRCN0000100342 CAGGGCTATAACGTCTGCATA pLKO.1 352 CDS 100% 4.950 6.930 N Rab11a n/a
4 TRCN0000353875 CAGGGCTATAACGTCTGCATA pLKO_005 352 CDS 100% 4.950 6.930 N Rab11a n/a
5 TRCN0000073020 CCTGTCTCGATTTACTCGAAA pLKO.1 214 CDS 100% 4.950 6.930 N RAB11A n/a
6 TRCN0000305795 AGTAGGTGCCTTATTGGTTTA pLKO_005 385 CDS 100% 10.800 8.640 N Rab11a n/a
7 TRCN0000305863 CACTTGAAGTTTAGACCTATT pLKO_005 1088 3UTR 100% 10.800 8.640 N Rab11a n/a
8 TRCN0000380662 TATCATGCTTGTGGGCAATAA pLKO_005 487 CDS 100% 13.200 9.240 N RAB11A n/a
9 TRCN0000381214 AGCAACAATGTGGTTCCTATT pLKO_005 707 CDS 100% 10.800 7.560 N RAB11A n/a
10 TRCN0000381243 AGTTGTCCTTATTGGAGATTC pLKO_005 172 CDS 100% 10.800 7.560 N RAB11A n/a
11 TRCN0000303291 ATCATGCTGATAGTAACATTG pLKO_005 465 CDS 100% 10.800 7.560 N RAB11A n/a
12 TRCN0000100341 GAGAGATCATGCTGATAGTAA pLKO.1 460 CDS 100% 5.625 3.938 N Rab11a n/a
13 TRCN0000324936 GAGAGATCATGCTGATAGTAA pLKO_005 460 CDS 100% 5.625 3.938 N Rab11a n/a
14 TRCN0000100343 ACCTCTTTAAAGTTGTCCTTA pLKO.1 162 CDS 100% 4.950 3.465 N Rab11a n/a
15 TRCN0000100340 CCCTGTAAACATAACAGCATT pLKO.1 1220 3UTR 100% 4.950 3.465 N Rab11a n/a
16 TRCN0000073022 GCCTTATTGGTTTATGACATT pLKO.1 392 CDS 100% 4.950 3.465 N RAB11A n/a
17 TRCN0000291939 GCCTTATTGGTTTATGACATT pLKO_005 392 CDS 100% 4.950 3.465 N RAB11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017382.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02009 pDONR223 100% 95.8% 100% None (many diffs) n/a
2 ccsbBroad304_02009 pLX_304 0% 95.8% 100% V5 (many diffs) n/a
3 TRCN0000475089 AGTACCGCGCTGCGCACCGTGATT pLX_317 41.4% 95.8% 100% V5 (many diffs) n/a
Download CSV