Construct: ORF TRCN0000475139
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002022.1_s317c1
- Derived from:
- ccsbBroadEn_00522
- DNA Barcode:
- CCTCCGCACGACCGATTCAGTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ETV6 (2120)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475139
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2120 | ETV6 | ETS variant transcription f... | NM_001987.5 | 100% | 100% | |
| 2 | human | 2120 | ETV6 | ETS variant transcription f... | XM_011520607.2 | 99.7% | 99.7% | 31_32insAGC |
| 3 | human | 2120 | ETV6 | ETS variant transcription f... | XM_011520608.2 | 97.8% | 97.5% | 0_1ins27;3_4delGCinsTA |
| 4 | human | 2120 | ETV6 | ETS variant transcription f... | XM_017018990.1 | 90% | 90% | 326_327ins135 |
| 5 | human | 2120 | ETV6 | ETS variant transcription f... | XM_011520609.2 | 80.5% | 80.5% | 0_1ins264 |
| 6 | human | 2120 | ETV6 | ETS variant transcription f... | XM_011520611.2 | 80.5% | 80.5% | 0_1ins264 |
| 7 | human | 2120 | ETV6 | ETS variant transcription f... | XM_017018991.1 | 80.5% | 80.5% | 0_1ins264 |
| 8 | human | 2120 | ETV6 | ETS variant transcription f... | XM_011520612.2 | 54.2% | 54.2% | 0_1ins621 |
| 9 | mouse | 14011 | Etv6 | ets variant 6 | NM_007961.4 | 81.4% | 81.9% | (many diffs) |
| 10 | mouse | 14011 | Etv6 | ets variant 6 | NM_001303102.1 | 73.9% | 74.5% | (many diffs) |
| 11 | mouse | 14011 | Etv6 | ets variant 6 | XM_011241206.2 | 73.9% | 74.5% | (many diffs) |
| 12 | mouse | 14011 | Etv6 | ets variant 6 | XM_011241207.2 | 73.9% | 74.5% | (many diffs) |
| 13 | mouse | 14011 | Etv6 | ets variant 6 | XM_011241208.2 | 73.9% | 74.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1422
- ORF length:
- 1356
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgagactcct gctcagtgta gcattaagca ggaacgaatt tcatatacac 121 ctccagagag cccagtgccg agttacgctt cctcgacgcc acttcatgtt ccagtgcctc 181 gagcgctcag gatggaggaa gactcgatcc gcctgcctgc gcacctgcgc ttgcagccaa 241 tttactggag cagggatgac gtagcccagt ggctcaagtg ggctgaaaat gagttttctt 301 taaggccaat tgacagcaac acgtttgaaa tgaatggcaa agctctcctg ctgctgacca 361 aagaggactt tcgctatcga tctcctcatt caggtgatgt gctctatgaa ctccttcagc 421 atattctgaa gcagaggaaa cctcggattc ttttttcacc attcttccac cctggaaact 481 ctatacacac acagccggag gtcatactgc atcagaacca tgaagaagat aactgtgtcc 541 agaggacccc caggccatcc gtggataatg tgcaccataa ccctcccacc attgaactgt 601 tgcaccgctc caggtcacct atcacgacaa atcaccggcc ttctcctgac cccgagcagc 661 ggcccctccg gtcccccctg gacaacatga tccgccgcct ctccccggct gagagagctc 721 agggacccag gccgcaccag gagaacaacc accaggagtc ctaccctctg tcagtgtctc 781 ccatggagaa taatcactgc ccagcgtcct ccgagtccca cccgaagcca tccagccccc 841 ggcaggagag cacacgcgtg atccagctga tgcccagccc catcatgcac cctctgatcc 901 tgaacccccg gcactccgtg gatttcaaac agtccaggct ctccgaggac gggctgcata 961 gggaagggaa gcccatcaac ctctctcatc gggaagacct ggcttacatg aaccacatca 1021 tggtctctgt ctccccgcct gaagagcacg ccatgcccat tgggagaata gcagactgta 1081 gactgctttg ggattacgtc tatcagttgc tttctgacag ccggtacgaa aacttcatcc 1141 GATGGGAGGA CAAAGAATCC AAAATATTCC GGATAGTGGA TCCCAACGGA CTGGCTCGAC 1201 TGTGGGGAAA CCATAAGAAC AGAACAAACA TGACCTATGA GAAAATGTCC AGAGCCCTGC 1261 GCCACTACTA CAAACTAAAC ATTATCAGGA AGGAGCCAGG ACAAAGGCTT TTGTTCAGGT 1321 TTATGAAAAC CCCAGATGAA ATCATGAGTG GCCGAACAGA CCGTCTGGAG CACCTAGAGT 1381 CCCAGGAGCT GGATGAACAA ATATACCAAG AAGATGAATG CTGCCCAACT TTCTTGTACA 1441 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1501 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1561 AGGACGACCT CCGCACGACC GATTCAGTGT CACGCGTTAA GTCgacaatc aacctctgga 1621 ttacaaaatt tgtgaaagat t