Transcript: Mouse XM_011241207.2

PREDICTED: Mus musculus ets variant 6 (Etv6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Etv6 (14011)
Length:
5395
CDS:
504..1832

Additional Resources:

NCBI RefSeq record:
XM_011241207.2
NBCI Gene record:
Etv6 (14011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003853 GCGCCACTACTACAAACTAAA pLKO.1 1556 CDS 100% 13.200 10.560 N ETV6 n/a
2 TRCN0000338363 GCGCCACTACTACAAACTAAA pLKO_005 1556 CDS 100% 13.200 10.560 N ETV6 n/a
3 TRCN0000231236 CAGTGTCTCCTGTCGAGAATA pLKO_005 1087 CDS 100% 13.200 9.240 N Etv6 n/a
4 TRCN0000257202 CTGCGTTTGCAGCCGATTTAC pLKO_005 537 CDS 100% 13.200 9.240 N Etv6 n/a
5 TRCN0000231235 TCAGAACCATGACGAAGATAA pLKO_005 824 CDS 100% 13.200 9.240 N Etv6 n/a
6 TRCN0000231237 TCGACATTAAAGCGACATTAA pLKO_005 4268 3UTR 100% 13.200 9.240 N Etv6 n/a
7 TRCN0000084402 GCTGCTGACCAAAGAGGATTT pLKO.1 662 CDS 100% 10.800 7.560 N Etv6 n/a
8 TRCN0000003856 CCATAAGAACAGAACAAACAT pLKO.1 1508 CDS 100% 5.625 3.938 N ETV6 n/a
9 TRCN0000338303 CCATAAGAACAGAACAAACAT pLKO_005 1508 CDS 100% 5.625 3.938 N ETV6 n/a
10 TRCN0000084400 CCGATTTACTGGAGCAGAGAT pLKO.1 549 CDS 100% 4.950 3.465 N Etv6 n/a
11 TRCN0000084398 CGCTTCTCCTTCTGATCTCTT pLKO.1 1950 3UTR 100% 4.950 3.465 N Etv6 n/a
12 TRCN0000084399 CCTGGCTTACTTGAACCACAT pLKO.1 1295 CDS 100% 4.050 2.835 N Etv6 n/a
13 TRCN0000084401 CTGCATCAGAACCATGACGAA pLKO.1 819 CDS 100% 2.640 1.848 N Etv6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00522 pDONR223 100% 73.9% 74.5% None (many diffs) n/a
2 TRCN0000475139 CCTCCGCACGACCGATTCAGTGTC pLX_317 21.2% 73.9% 74.5% V5 (many diffs) n/a
3 ccsbBroad304_00522 pLX_304 51.9% 68.9% 38% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV