Construct: ORF TRCN0000475364
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015301.1_s317c1
- Derived from:
- ccsbBroadEn_09584
- DNA Barcode:
- AACCCGTCACCTGGAGGACTCAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCP10L (140290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475364
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140290 | TCP10L | t-complex 10 like | NM_144659.7 | 99.8% | 100% | 36A>G |
| 2 | human | 401285 | TCP10L2 | t-complex 10 like 2 | NM_001145121.2 | 54.2% | 47.3% | (many diffs) |
| 3 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NM_001350338.2 | 51.6% | 43.4% | (many diffs) |
| 4 | human | 401285 | TCP10L2 | t-complex 10 like 2 | XM_017010859.2 | 45.9% | 40% | (many diffs) |
| 5 | human | 6953 | TCP10 | t-complex 10 | NR_163194.1 | 44.9% | (many diffs) | |
| 6 | human | 401285 | TCP10L2 | t-complex 10 like 2 | XR_001743415.1 | 22.3% | (many diffs) | |
| 7 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NR_146638.2 | 8.2% | (many diffs) | |
| 8 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NR_146639.2 | 8.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 711
- ORF length:
- 645
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggcaggtcaa ctcgaggcca gggaccccaa ggagggcacc cacccagagg 121 acccgtgccc aggagctggg gctgtcatgg agaagacagc tgtggcagcc gaggttctca 181 cggaggactg caacactggg gagatgccac cattacagca gcagatcatc agactccacc 241 aagagcttgg gagacagaag tctctgtggg ctgatgttca tggaaaactc cggagtcata 301 tagatgcttt gagggagcag aacatggagc tccgagaaaa gctgagagct ctgcagctgc 361 agcggtggaa agccaggaag aaatctgcag cgtccccaca cgcggggcaa gaatcgcaca 421 ctctggcatt ggaacctgct tttggaaaaa tttcacctct gtcagctgat gaagagacaa 481 tacccaaata cgctGGCCAC AAGAATCAGA GTGCCACTCT CCTGGGACAA AGATCGTCAT 541 CTAACAATTC AGCTCCTCCA AAGCCAATGA GTTTAAAGAT AGAAAGAATT AGCTCGTGGA 601 AAACACCACC ACAGGAAAAT AGAGATAAAA ATCTTTCCAG GAGACGTCAA GACAGAAGAG 661 CAACACCTAC TGGAAGGCCA ACTCCCTGTG CAGAGAGACG GGGGGGTGTC TGCCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGAAACC CGTCACCTGG AGGACTCAGC ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt