Transcript: Human NM_144659.7

Homo sapiens t-complex 10 like (TCP10L), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TCP10L (140290)
Length:
3805
CDS:
105..752

Additional Resources:

NCBI RefSeq record:
NM_144659.7
NBCI Gene record:
TCP10L (140290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144659.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160413 CGCATTAGGATACTGATATTT pLKO.1 2779 3UTR 100% 15.000 7.500 Y TCP10L n/a
2 TRCN0000162265 CCTCCAAAGCCAATGAGTTTA pLKO.1 594 CDS 100% 13.200 6.600 Y TCP10 n/a
3 TRCN0000164616 CAGGAACCTATCTTGGTAAAG pLKO.1 1875 3UTR 100% 10.800 5.400 Y TCP10L n/a
4 TRCN0000164089 CTGGTTGAGTCAGGAAAGAAT pLKO.1 1802 3UTR 100% 5.625 2.813 Y TCP10L n/a
5 TRCN0000158996 GAACCTATCTTGGTAAAGAAA pLKO.1 1878 3UTR 100% 5.625 2.813 Y TCP10L n/a
6 TRCN0000166490 CCACGTTCAACCTGATGAGTT pLKO.1 2896 3UTR 100% 4.950 2.475 Y TCP10L n/a
7 TRCN0000150234 GAAAGAATTAGCTCGTGGAAA pLKO.1 621 CDS 100% 4.950 2.475 Y TCP10L n/a
8 TRCN0000166093 GCTCCTCAGTCTTAGAGAGTT pLKO.1 2856 3UTR 100% 4.950 2.475 Y TCP10L n/a
9 TRCN0000180522 GTGGGCTGATGTTCATGGAAA pLKO.1 305 CDS 100% 4.950 2.475 Y TCP10L n/a
10 TRCN0000147591 GATGAAGAGACAATACCCAAA pLKO.1 507 CDS 100% 4.050 2.025 Y TCP10L n/a
11 TRCN0000146309 CAGATAAAGTTCCACTTAGGT pLKO.1 816 3UTR 100% 3.000 1.500 Y TCP10L n/a
12 TRCN0000180386 GAAGAGCAACACCTACTGGAA pLKO.1 694 CDS 100% 2.640 1.320 Y TCP10L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144659.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09584 pDONR223 100% 99.8% 100% None 36A>G n/a
2 ccsbBroad304_09584 pLX_304 0% 99.8% 100% V5 36A>G n/a
3 TRCN0000475364 AACCCGTCACCTGGAGGACTCAGC pLX_317 34.1% 99.8% 100% V5 36A>G n/a
4 ccsbBroadEn_07042 pDONR223 100% 54% 46.7% None (many diffs) n/a
5 ccsbBroad304_07042 pLX_304 0% 54% 46.7% V5 (many diffs) n/a
6 TRCN0000465286 ATGAAGCAAAAACATACAATAAAT pLX_317 33.4% 54% 46.7% V5 (many diffs) n/a
Download CSV