Transcript: Human NM_001350338.2

Homo sapiens C21orf59-TCP10L readthrough (C21orf59-TCP10L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
C21orf59-TCP10L (110091775)
Length:
4357
CDS:
135..1304

Additional Resources:

NCBI RefSeq record:
NM_001350338.2
NBCI Gene record:
C21orf59-TCP10L (110091775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160413 CGCATTAGGATACTGATATTT pLKO.1 3331 3UTR 100% 15.000 7.500 Y TCP10L n/a
2 TRCN0000137849 GCAGGGCTCAACGTCATTAAA pLKO.1 669 CDS 100% 15.000 7.500 Y CFAP298 n/a
3 TRCN0000162265 CCTCCAAAGCCAATGAGTTTA pLKO.1 1146 CDS 100% 13.200 6.600 Y TCP10 n/a
4 TRCN0000421040 AGGAATGGGCAAGCTCCAAAT pLKO_005 429 CDS 100% 10.800 5.400 Y CFAP298 n/a
5 TRCN0000434680 ATTGAAATTGAAGGATGAATG pLKO_005 350 CDS 100% 10.800 5.400 Y CFAP298 n/a
6 TRCN0000164616 CAGGAACCTATCTTGGTAAAG pLKO.1 2427 3UTR 100% 10.800 5.400 Y TCP10L n/a
7 TRCN0000435440 AGTGTTAAAGAAGACTATAGA pLKO_005 464 CDS 100% 5.625 2.813 Y CFAP298 n/a
8 TRCN0000135104 CTGACCGATGATCAGATTGAA pLKO.1 327 CDS 100% 5.625 2.813 Y CFAP298 n/a
9 TRCN0000164089 CTGGTTGAGTCAGGAAAGAAT pLKO.1 2354 3UTR 100% 5.625 2.813 Y TCP10L n/a
10 TRCN0000158996 GAACCTATCTTGGTAAAGAAA pLKO.1 2430 3UTR 100% 5.625 2.813 Y TCP10L n/a
11 TRCN0000166490 CCACGTTCAACCTGATGAGTT pLKO.1 3448 3UTR 100% 4.950 2.475 Y TCP10L n/a
12 TRCN0000150234 GAAAGAATTAGCTCGTGGAAA pLKO.1 1173 CDS 100% 4.950 2.475 Y TCP10L n/a
13 TRCN0000166093 GCTCCTCAGTCTTAGAGAGTT pLKO.1 3408 3UTR 100% 4.950 2.475 Y TCP10L n/a
14 TRCN0000180522 GTGGGCTGATGTTCATGGAAA pLKO.1 857 CDS 100% 4.950 2.475 Y TCP10L n/a
15 TRCN0000429717 AGGAAGACTTGTCGGGAACAC pLKO_005 646 CDS 100% 4.050 2.025 Y CFAP298 n/a
16 TRCN0000147591 GATGAAGAGACAATACCCAAA pLKO.1 1059 CDS 100% 4.050 2.025 Y TCP10L n/a
17 TRCN0000138318 CAAGGAGCTGAGAAGAACGAA pLKO.1 719 CDS 100% 3.000 1.500 Y CFAP298 n/a
18 TRCN0000146309 CAGATAAAGTTCCACTTAGGT pLKO.1 1368 3UTR 100% 3.000 1.500 Y TCP10L n/a
19 TRCN0000180386 GAAGAGCAACACCTACTGGAA pLKO.1 1246 CDS 100% 2.640 1.320 Y TCP10L n/a
20 TRCN0000137892 GATGGTGAAAGATGCCTTGGA pLKO.1 545 CDS 100% 2.640 1.320 Y CFAP298 n/a
21 TRCN0000423548 TATCGCCAAGATTCAGCAAAG pLKO_005 782 CDS 100% 6.000 3.000 Y CFAP298 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03741 pDONR223 100% 69.2% 56.9% None (many diffs) n/a
2 ccsbBroad304_03741 pLX_304 0% 69.2% 56.9% V5 (many diffs) n/a
3 TRCN0000474470 TGCGATTAAGAACCGAAAGTTTCA pLX_317 37.6% 69.2% 56.9% V5 (many diffs) n/a
4 ccsbBroadEn_09584 pDONR223 100% 51.6% 43.4% None (many diffs) n/a
5 ccsbBroad304_09584 pLX_304 0% 51.6% 43.4% V5 (many diffs) n/a
6 TRCN0000475364 AACCCGTCACCTGGAGGACTCAGC pLX_317 34.1% 51.6% 43.4% V5 (many diffs) n/a
Download CSV