Transcript: Human XR_001743415.1

PREDICTED: Homo sapiens t-complex 10 like 2 (TCP10L2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCP10L2 (401285)
Length:
2569
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743415.1
NBCI Gene record:
TCP10L2 (401285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433227 TATCTTCCAGCCACCACATTT pLKO_005 1386 3UTR 100% 13.200 9.240 N TCP10L2 n/a
2 TRCN0000413781 GCTACTTGCAGTAACAGTTTG pLKO_005 1737 3UTR 100% 10.800 7.560 N TCP10L2 n/a
3 TRCN0000154455 GAGTTGCTGACAGAAGCTCAT pLKO.1 958 3UTR 100% 4.050 2.835 N TCP10L2 n/a
4 TRCN0000162265 CCTCCAAAGCCAATGAGTTTA pLKO.1 687 3UTR 100% 13.200 6.600 Y TCP10 n/a
5 TRCN0000161466 GTGTCTGAAGACGGAAAGATT pLKO.1 837 3UTR 100% 5.625 2.813 Y TCP10 n/a
6 TRCN0000158642 CCAATGAGTTTAAAGACAGAA pLKO.1 696 3UTR 100% 4.950 2.475 Y TCP10 n/a
7 TRCN0000154421 GCTCATCAGTCTTAGGGAGTT pLKO.1 973 3UTR 100% 4.050 2.025 Y TCP10L2 n/a
8 TRCN0000163414 GCTCATCAGTCTTAGGGAGTT pLKO.1 973 3UTR 100% 4.050 2.025 Y TCP10 n/a
9 TRCN0000151330 GAAGACGGAAAGATTATGCAT pLKO.1 843 3UTR 100% 3.000 1.500 Y TCP10L2 n/a
10 TRCN0000163601 CCAGAGTCATATGGATGCCTT pLKO.1 422 3UTR 100% 0.000 0.000 Y TCP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07042 pDONR223 100% 40.6% None (many diffs) n/a
2 ccsbBroad304_07042 pLX_304 0% 40.6% V5 (many diffs) n/a
3 TRCN0000465286 ATGAAGCAAAAACATACAATAAAT pLX_317 33.4% 40.6% V5 (many diffs) n/a
4 ccsbBroadEn_09584 pDONR223 100% 22.3% None (many diffs) n/a
5 ccsbBroad304_09584 pLX_304 0% 22.3% V5 (many diffs) n/a
6 TRCN0000475364 AACCCGTCACCTGGAGGACTCAGC pLX_317 34.1% 22.3% V5 (many diffs) n/a
Download CSV