Construct: ORF TRCN0000475424
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012603.1_s317c1
- Derived from:
- ccsbBroadEn_11108
- DNA Barcode:
- TAGAGACTTCGCATCTAGTGTCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPS4X (6191)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475424
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6191 | RPS4X | ribosomal protein S4 X-linked | NM_001007.5 | 75.1% | 75.2% | 1_195del;492G>A |
2 | human | 6192 | RPS4Y1 | ribosomal protein S4 Y-link... | NM_001008.4 | 62.1% | 68.4% | (many diffs) |
3 | human | 140032 | RPS4Y2 | ribosomal protein S4 Y-link... | NM_001039567.3 | 61.6% | 67.3% | (many diffs) |
4 | mouse | 20102 | Rps4x | ribosomal protein S4, X-linked | XM_011247553.2 | 73.7% | 80.8% | (many diffs) |
5 | mouse | 20102 | Rps4x | ribosomal protein S4, X-linked | NM_009094.2 | 68.6% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 660
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcggttcatt aaaatcgatg gcaaggtccg aactgatata acctaccctg 121 ctggattcat ggatgtcatc agcattgaca agacgggaga gaatttccgt ctgatctatg 181 acaccaaggg tcgctttgct gtacatcgta ttacacctga ggaggccaag tacaagttgt 241 gcaaagtgag aaagatcttt gtgggcacaa aaggaatccc tcatctggtg actcatgatg 301 cccgcaccat ccgctacccc gatcccctca tcaaggtgaa tgataccatt cagattgatt 361 tagagactgg caagattact gatttcatca agttcGACAC TGGTAACCTG TGTATGGTGA 421 CTGGAGGTGC TAACCTAGGA AGAATTGGTG TGATCACCAA CAGAGAGAGG CACCCTGGAT 481 CTTTTGACGT GGTTCACGTG AAAGATGCCA ATGGCAACAG CTTTGCCACT CGACTTTCCA 541 ACATTTTTGT TATTGGCAAG GGCAACAAAC CATGGATTTC TCTTCCCCGA GGAAAGGGTA 601 TCCGCCTCAC CATTGCTGAA GAGAGAGACA AAAGACTGGC GGCCAAACAG AGCAGTGGGT 661 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGATAGAG ACTTCGCATC TAGTGTCTCA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt