Transcript: Mouse XM_011247553.2

PREDICTED: Mus musculus ribosomal protein S4, X-linked (Rps4x), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps4x (20102)
Length:
896
CDS:
71..808

Additional Resources:

NCBI RefSeq record:
XM_011247553.2
NBCI Gene record:
Rps4x (20102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104503 GCAGCGATTCATTAAGATTGA pLKO.1 214 CDS 100% 4.950 6.930 N Rps4x n/a
2 TRCN0000349174 GCAGCGATTCATTAAGATTGA pLKO_005 214 CDS 100% 4.950 6.930 N Rps4x n/a
3 TRCN0000104501 CCGTCTGATCTATGACACCAA pLKO.1 313 CDS 100% 2.640 3.696 N Rps4x n/a
4 TRCN0000316534 CCGTCTGATCTATGACACCAA pLKO_005 313 CDS 100% 2.640 3.696 N Rps4x n/a
5 TRCN0000104500 CGACACCATTCAGATTGATTT pLKO.1 487 CDS 100% 13.200 10.560 N Rps4x n/a
6 TRCN0000316531 CGACACCATTCAGATTGATTT pLKO_005 487 CDS 100% 13.200 10.560 N Rps4x n/a
7 TRCN0000104504 GCTTTGCTGTTCATCGTATTA pLKO.1 339 CDS 100% 13.200 9.240 N Rps4x n/a
8 TRCN0000316604 GCTTTGCTGTTCATCGTATTA pLKO_005 339 CDS 100% 13.200 9.240 N Rps4x n/a
9 TRCN0000104502 CCCTGACTGGAGATGAAGTAA pLKO.1 180 CDS 100% 5.625 3.938 N Rps4x n/a
10 TRCN0000316606 CCCTGACTGGAGATGAAGTAA pLKO_005 180 CDS 100% 5.625 3.938 N Rps4x n/a
11 TRCN0000074713 GCCAAGTACAAGTTGTGCAAA pLKO.1 371 CDS 100% 4.950 2.970 N RPS4X n/a
12 TRCN0000307033 GCCAAGTACAAGTTGTGCAAA pLKO_005 371 CDS 100% 4.950 2.970 N RPS4X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06892 pDONR223 100% 84.5% 93.1% None (many diffs) n/a
2 ccsbBroad304_06892 pLX_304 0% 84.5% 93.1% V5 (many diffs) n/a
3 TRCN0000472377 TCTGGATAGTTTGTGCCCCTCAAC pLX_317 61.4% 84.5% 93.1% V5 (many diffs) n/a
4 ccsbBroadEn_06893 pDONR223 100% 75.6% 86.3% None (many diffs) n/a
5 ccsbBroad304_06893 pLX_304 0% 75.6% 86.3% V5 (many diffs) n/a
6 TRCN0000469133 CCCGAAGAAAGTCTACAGATGCCT pLX_317 48.5% 75.6% 86.3% V5 (many diffs) n/a
7 ccsbBroadEn_15579 pDONR223 0% 75.5% 85.9% None (many diffs) n/a
8 ccsbBroad304_15579 pLX_304 0% 75.5% 85.9% V5 (many diffs) n/a
9 TRCN0000467035 TAGACGGCAAACCGAACAATATTT pLX_317 36% 75.5% 85.9% V5 (many diffs) n/a
10 ccsbBroadEn_11108 pDONR223 100% 73.7% 80.8% None (many diffs) n/a
11 ccsbBroad304_11108 pLX_304 0% 73.7% 80.8% V5 (many diffs) n/a
12 TRCN0000475424 TAGAGACTTCGCATCTAGTGTCTC pLX_317 44.7% 73.7% 80.8% V5 (many diffs) n/a
Download CSV