Transcript: Human NM_001007.5

Homo sapiens ribosomal protein S4 X-linked (RPS4X), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RPS4X (6191)
Length:
1474
CDS:
54..845

Additional Resources:

NCBI RefSeq record:
NM_001007.5
NBCI Gene record:
RPS4X (6191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074717 CCACTCGACTTTCCAACATTT pLKO.1 709 CDS 100% 13.200 18.480 N RPS4X n/a
2 TRCN0000289113 CCACTCGACTTTCCAACATTT pLKO_005 709 CDS 100% 13.200 18.480 N RPS4X n/a
3 TRCN0000074715 GTTCACGTGAAAGATGCCAAT pLKO.1 675 CDS 100% 4.050 2.835 N RPS4X n/a
4 TRCN0000289114 GTTCACGTGAAAGATGCCAAT pLKO_005 675 CDS 100% 4.050 2.835 N RPS4X n/a
5 TRCN0000104501 CCGTCTGATCTATGACACCAA pLKO.1 350 CDS 100% 2.640 1.848 N Rps4x n/a
6 TRCN0000316534 CCGTCTGATCTATGACACCAA pLKO_005 350 CDS 100% 2.640 1.848 N Rps4x n/a
7 TRCN0000284605 TGATACCATTCAGATTGATTT pLKO_005 524 CDS 100% 13.200 7.920 N Gm9294 n/a
8 TRCN0000074713 GCCAAGTACAAGTTGTGCAAA pLKO.1 408 CDS 100% 4.950 2.970 N RPS4X n/a
9 TRCN0000307033 GCCAAGTACAAGTTGTGCAAA pLKO_005 408 CDS 100% 4.950 2.970 N RPS4X n/a
10 TRCN0000074714 CCACAAGTTGAGAGAGTGTCT pLKO.1 158 CDS 100% 2.640 1.320 Y RPS4X n/a
11 TRCN0000289170 CCACAAGTTGAGAGAGTGTCT pLKO_005 158 CDS 100% 2.640 1.320 Y RPS4X n/a
12 TRCN0000074716 GCTGGATAAATTGACCGGTGT pLKO.1 110 CDS 100% 2.160 1.080 Y RPS4X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06892 pDONR223 100% 99.2% 100% None (many diffs) n/a
2 ccsbBroad304_06892 pLX_304 0% 99.2% 100% V5 (many diffs) n/a
3 TRCN0000472377 TCTGGATAGTTTGTGCCCCTCAAC pLX_317 61.4% 99.2% 100% V5 (many diffs) n/a
4 ccsbBroadEn_06893 pDONR223 100% 82.2% 93.1% None (many diffs) n/a
5 ccsbBroad304_06893 pLX_304 0% 82.2% 93.1% V5 (many diffs) n/a
6 TRCN0000469133 CCCGAAGAAAGTCTACAGATGCCT pLX_317 48.5% 82.2% 93.1% V5 (many diffs) n/a
7 ccsbBroadEn_15579 pDONR223 0% 82.1% 92.7% None (many diffs) n/a
8 ccsbBroad304_15579 pLX_304 0% 82.1% 92.7% V5 (many diffs) n/a
9 TRCN0000467035 TAGACGGCAAACCGAACAATATTT pLX_317 36% 82.1% 92.7% V5 (many diffs) n/a
10 ccsbBroadEn_11108 pDONR223 100% 75.1% 75.2% None 1_195del;492G>A n/a
11 ccsbBroad304_11108 pLX_304 0% 75.1% 75.2% V5 1_195del;492G>A n/a
12 TRCN0000475424 TAGAGACTTCGCATCTAGTGTCTC pLX_317 44.7% 75.1% 75.2% V5 1_195del;492G>A n/a
Download CSV