Transcript: Human NM_001008.4

Homo sapiens ribosomal protein S4 Y-linked 1 (RPS4Y1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RPS4Y1 (6192)
Length:
1189
CDS:
24..815

Additional Resources:

NCBI RefSeq record:
NM_001008.4
NBCI Gene record:
RPS4Y1 (6192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074741 CCACGAGGCTTTCCAACATTT pLKO.1 679 CDS 100% 13.200 9.240 N RPS4Y1 n/a
2 TRCN0000074742 GACAAACTAACGGGTGTATTT pLKO.1 84 CDS 100% 13.200 9.240 N RPS4Y1 n/a
3 TRCN0000416496 GCAATTTGTGTATGGTGATTG pLKO_005 556 CDS 100% 10.800 7.560 N RPS4Y1 n/a
4 TRCN0000437876 CAAGGTTCGAGTGGATGTCAC pLKO_005 245 CDS 100% 4.050 2.835 N RPS4Y1 n/a
5 TRCN0000074739 CCTGTCATCAAGGTGAACGAT pLKO.1 477 CDS 100% 3.000 1.800 N RPS4Y1 n/a
6 TRCN0000074740 CTCAGGAATAGACTCAAGTAT pLKO.1 165 CDS 100% 5.625 2.813 Y RPS4Y1 n/a
7 TRCN0000074738 CCTCAGGAATAGACTCAAGTA pLKO.1 164 CDS 100% 4.950 2.475 Y RPS4Y1 n/a
8 TRCN0000117597 GCAAAGTACAAGTTGTGCAAA pLKO.1 378 CDS 100% 4.950 2.475 Y RPS4Y2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15579 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15579 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467035 TAGACGGCAAACCGAACAATATTT pLX_317 36% 100% 100% V5 n/a
4 ccsbBroadEn_06893 pDONR223 100% 99.7% 99.6% None 771_772delCAinsTG n/a
5 ccsbBroad304_06893 pLX_304 0% 99.7% 99.6% V5 771_772delCAinsTG n/a
6 TRCN0000469133 CCCGAAGAAAGTCTACAGATGCCT pLX_317 48.5% 99.7% 99.6% V5 771_772delCAinsTG n/a
7 ccsbBroadEn_06892 pDONR223 100% 82.7% 92.7% None (many diffs) n/a
8 ccsbBroad304_06892 pLX_304 0% 82.7% 92.7% V5 (many diffs) n/a
9 TRCN0000472377 TCTGGATAGTTTGTGCCCCTCAAC pLX_317 61.4% 82.7% 92.7% V5 (many diffs) n/a
10 ccsbBroadEn_11108 pDONR223 100% 62.1% 68.4% None (many diffs) n/a
11 ccsbBroad304_11108 pLX_304 0% 62.1% 68.4% V5 (many diffs) n/a
12 TRCN0000475424 TAGAGACTTCGCATCTAGTGTCTC pLX_317 44.7% 62.1% 68.4% V5 (many diffs) n/a
Download CSV