Construct: ORF TRCN0000475447
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012088.1_s317c1
- Derived from:
- ccsbBroadEn_14243
- DNA Barcode:
- CACGGCAAATACCAGAGTTCGTAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- OSGEPL1 (64172)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475447
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NM_022353.3 | 99.8% | 98.5% | 1026T>C;1226delA |
2 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_005246766.3 | 99.8% | 98.5% | 1026T>C;1226delA |
3 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_006712685.1 | 99.8% | 98.5% | 1026T>C;1226delA |
4 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_011511631.1 | 99.8% | 98.5% | 1026T>C;1226delA |
5 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004676.1 | 99.8% | 98.5% | 1026T>C;1226delA |
6 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004677.1 | 99.8% | 98.5% | 1026T>C;1226delA |
7 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004678.1 | 99.8% | 98.5% | 1026T>C;1226delA |
8 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004679.1 | 99.8% | 98.5% | 1026T>C;1226delA |
9 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004680.1 | 99.8% | 98.5% | 1026T>C;1226delA |
10 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NM_001354347.1 | 97.2% | 96% | 1_33del;1059T>C;1259delA |
11 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453039.1 | 97.2% | 96% | 1_33del;1059T>C;1259delA |
12 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453040.1 | 97.2% | 96% | 1_33del;1059T>C;1259delA |
13 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453041.1 | 97.2% | 96% | 1_33del;1059T>C;1259delA |
14 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XR_922985.2 | 65.9% | (many diffs) | |
15 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_006712686.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
16 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004681.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
17 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004682.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
18 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004683.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
19 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004684.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
20 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453042.1 | 64.3% | 63% | 0_1ins441;585T>C;785delA |
21 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004685.2 | 60.6% | 59.4% | (many diffs) |
22 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XR_002959323.1 | 58% | (many diffs) | |
23 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NR_148883.1 | 51.7% | (many diffs) | |
24 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | NM_001285839.1 | 85.2% | 84.2% | (many diffs) |
25 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | XM_006496290.3 | 55.7% | 55.5% | (many diffs) |
26 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | NR_104361.1 | 54.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1293
- ORF length:
- 1227
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct aatcttgact aagactgcag gagttttttt taaaccatca aaaaggaaag 121 tttatgaatt tttaagaagt tttaattttc atcctggaac actatttctt cataaaatag 181 tattgggaat tgaaactagt tgtgatgata cagcagctgc tgtggtggat gaaactggaa 241 atgtgttggg agaagcaata cattcccaaa ctgaagttca tttaaaaaca ggtgggattg 301 ttcctccagc agctcaacag cttcacagag aaaatattca acgaatagta caagaagctc 361 tttctgccag tggagtctct ccaagtgacc tctcagcaat tgcaactacc ataaaaccag 421 gacttgcttt aagcctggga gtgggcttat catttagctt acagctggta ggacagttaa 481 aaaagccatt cattcccatt catcatatgg aggctcatgc acttactatt aggttgacca 541 ataaagtaga atttcctttt ttagttcttt tgatttctgg aggtcactgt ctgttggcat 601 tagttcaagg agtttcagat tttctgcttc ttggaaagtc tttggacata gcaccaggtg 661 acatgcttga caaggtggca agaagacttt ctttaataaa acatccagag tgctccaCCA 721 TGAGTGGTGG GAAAGCCATA GAACATTTGG CCAAACAAGG AAATAGATTT CATTTTGACA 781 TCAAACCTCC CTTGCATCAT GCTAAAAATT GTGATTTTTC TTTTACTGGA CTTCAACACG 841 TTACTGATAA AATAATAATG AAAAAGGAAA AAGAGGAAGG TATTGAGAAG GGGCAAATCC 901 TGTCTTCAGC AGCAGACATT GCTGCCACAG TACAGCACAC AATGGCATGT CATCTTGTGA 961 AAAGAACACA TCGGGCTATT CTGTTTTGTA AGCAGAGAGA CTTGTTACCT CAAAATAATG 1021 CAGTACTGGT TGCATCTGGT GGTGTCGCAA GTAACTTCTA TATCCGCAGA GCTCTGGAAA 1081 TTTTAACAAA CGCAACACAG TGCACTTTGT TGTGTCCTCC TCCCAGACTA TGCACTGATA 1141 ATGGCATTAT GATTGCATGG AATGGTATTG AAAGACTACG TGCTGGCTTG GGCATTTTAC 1201 ATGACATAGA AGGCATCCGC TATGAACCAA AATGTCCTCT TGGAGTAGAC ATATCAAAAG 1261 AAGTTGGAGA AGCTTCCATA AAAGTACCAC ATTAAAAATG GAGATATGCC CAACTTTCTT 1321 GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC 1381 GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG 1441 TGGAAAGGAC GACACGGCAA ATACCAGAGT TCGTACACGC GTTAAGTCga caatcaacct 1501 ctggattaca aaatttgtga aagatt