Transcript: Mouse NR_104361.1

Mus musculus O-sialoglycoprotein endopeptidase-like 1 (Osgepl1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Osgepl1 (72085)
Length:
1948
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104361.1
NBCI Gene record:
Osgepl1 (72085)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032892 GTAGAAGACATCCGATATGAA pLKO.1 1479 3UTR 100% 5.625 7.875 N Osgepl1 n/a
2 TRCN0000032891 CGAATAGTAGAAGAAACTCTT pLKO.1 535 3UTR 100% 4.950 6.930 N Osgepl1 n/a
3 TRCN0000032889 CCAAGCGATCTCTCAGCAATT pLKO.1 574 3UTR 100% 10.800 7.560 N Osgepl1 n/a
4 TRCN0000032890 GAATGCTAAGAATTGCGATTT pLKO.1 990 3UTR 100% 10.800 7.560 N Osgepl1 n/a
5 TRCN0000032893 CCTTGGGAAGTCTTTGGACAT pLKO.1 822 3UTR 100% 4.050 2.835 N Osgepl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14243 pDONR223 100% 54.4% None (many diffs) n/a
2 ccsbBroad304_14243 pLX_304 0% 54.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475447 CACGGCAAATACCAGAGTTCGTAC pLX_317 47.5% 54.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491358 ATTACTGGTTTCGTATTTGGTGCA pLX_317 26.2% 54.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV