Transcript: Human XM_017004679.1

PREDICTED: Homo sapiens O-sialoglycoprotein endopeptidase like 1 (OSGEPL1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSGEPL1 (64172)
Length:
1864
CDS:
266..1510

Additional Resources:

NCBI RefSeq record:
XM_017004679.1
NBCI Gene record:
OSGEPL1 (64172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047051 GTGTCGCAAGTAACTTCTATA pLKO.1 1242 CDS 100% 13.200 18.480 N OSGEPL1 n/a
2 TRCN0000047049 GCAATACATTCCCAAACTGAA pLKO.1 455 CDS 100% 4.950 6.930 N OSGEPL1 n/a
3 TRCN0000421688 CTTCAACACGTTACTGATAAA pLKO_005 1031 CDS 100% 13.200 10.560 N OSGEPL1 n/a
4 TRCN0000423130 ACTATTAGGTTGACCAATAAA pLKO_005 725 CDS 100% 15.000 10.500 N OSGEPL1 n/a
5 TRCN0000047050 CCAAGTGACCTCTCAGCAATT pLKO.1 581 CDS 100% 10.800 7.560 N OSGEPL1 n/a
6 TRCN0000047048 CCTCCCTTGCATCATGCTAAA pLKO.1 986 CDS 100% 10.800 7.560 N OSGEPL1 n/a
7 TRCN0000047052 CTATGCACTGATAATGGCATT pLKO.1 1328 CDS 100% 4.050 2.835 N OSGEPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491358 ATTACTGGTTTCGTATTTGGTGCA pLX_317 26.2% 99.9% 100% V5 (not translated due to prior stop codon) 1026T>C n/a
2 ccsbBroadEn_14243 pDONR223 100% 99.8% 98.5% None 1026T>C;1226delA n/a
3 ccsbBroad304_14243 pLX_304 0% 99.8% 98.5% V5 (not translated due to prior stop codon) 1026T>C;1226delA n/a
4 TRCN0000475447 CACGGCAAATACCAGAGTTCGTAC pLX_317 47.5% 99.8% 98.5% V5 (not translated due to prior stop codon) 1026T>C;1226delA n/a
Download CSV