Transcript: Human XM_017004681.1

PREDICTED: Homo sapiens O-sialoglycoprotein endopeptidase like 1 (OSGEPL1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSGEPL1 (64172)
Length:
2034
CDS:
531..1334

Additional Resources:

NCBI RefSeq record:
XM_017004681.1
NBCI Gene record:
OSGEPL1 (64172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047051 GTGTCGCAAGTAACTTCTATA pLKO.1 1066 CDS 100% 13.200 18.480 N OSGEPL1 n/a
2 TRCN0000421688 CTTCAACACGTTACTGATAAA pLKO_005 855 CDS 100% 13.200 10.560 N OSGEPL1 n/a
3 TRCN0000423130 ACTATTAGGTTGACCAATAAA pLKO_005 549 CDS 100% 15.000 10.500 N OSGEPL1 n/a
4 TRCN0000047050 CCAAGTGACCTCTCAGCAATT pLKO.1 405 5UTR 100% 10.800 7.560 N OSGEPL1 n/a
5 TRCN0000047048 CCTCCCTTGCATCATGCTAAA pLKO.1 810 CDS 100% 10.800 7.560 N OSGEPL1 n/a
6 TRCN0000047052 CTATGCACTGATAATGGCATT pLKO.1 1152 CDS 100% 4.050 2.835 N OSGEPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491358 ATTACTGGTTTCGTATTTGGTGCA pLX_317 26.2% 64.4% 64.4% V5 (not translated due to prior stop codon) 0_1ins441;585T>C n/a
2 ccsbBroadEn_14243 pDONR223 100% 64.3% 63% None 0_1ins441;585T>C;785delA n/a
3 ccsbBroad304_14243 pLX_304 0% 64.3% 63% V5 (not translated due to prior stop codon) 0_1ins441;585T>C;785delA n/a
4 TRCN0000475447 CACGGCAAATACCAGAGTTCGTAC pLX_317 47.5% 64.3% 63% V5 (not translated due to prior stop codon) 0_1ins441;585T>C;785delA n/a
Download CSV