Transcript: Human XM_017005110.1

PREDICTED: Homo sapiens ST6 beta-galactoside alpha-2,6-sialyltransferase 2 (ST6GAL2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST6GAL2 (84620)
Length:
3410
CDS:
141..1568

Additional Resources:

NCBI RefSeq record:
XM_017005110.1
NBCI Gene record:
ST6GAL2 (84620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035110 CGCATCATTAATTCGCAGATT pLKO.1 1164 CDS 100% 4.950 6.930 N ST6GAL2 n/a
2 TRCN0000035111 GCATCGTCAGAGAAACCCAAA pLKO.1 1328 CDS 100% 4.050 5.670 N ST6GAL2 n/a
3 TRCN0000035109 CGCAAATCTTAACCTGTGGTA pLKO.1 1268 CDS 100% 2.640 3.696 N ST6GAL2 n/a
4 TRCN0000035112 CAGTCCCAAGATGGGTTTGAA pLKO.1 441 CDS 100% 5.625 3.938 N ST6GAL2 n/a
5 TRCN0000035113 CGTGGTTATGAGAAAGATGTT pLKO.1 1125 CDS 100% 4.950 3.465 N ST6GAL2 n/a
6 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1562 CDS 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12833 pDONR223 100% 92.3% 88.1% None (many diffs) n/a
2 ccsbBroad304_12833 pLX_304 0% 92.3% 88.1% V5 (many diffs) n/a
3 TRCN0000475492 TTAGCCAACGAATTTCATCAAGCA pLX_317 26.8% 92.3% 88.1% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 6.2% 3.9% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 6.2% 3.9% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 6.2% 3.9% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 6.1% 3.9% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 6.1% 3.9% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 6.1% 3.9% V5 (many diffs) n/a
Download CSV