Construct: ORF TRCN0000475513
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002155.1_s317c1
- Derived from:
- ccsbBroadEn_01012
- DNA Barcode:
- CACTGTGGAATTACTCCATAACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MID1 (4281)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475513
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4281 | MID1 | midline 1 | NM_000381.4 | 100% | 100% | |
| 2 | human | 4281 | MID1 | midline 1 | NM_001098624.2 | 100% | 100% | |
| 3 | human | 4281 | MID1 | midline 1 | NM_001193277.1 | 100% | 100% | |
| 4 | human | 4281 | MID1 | midline 1 | NM_001347733.2 | 100% | 100% | |
| 5 | human | 4281 | MID1 | midline 1 | NM_033290.4 | 100% | 100% | |
| 6 | human | 4281 | MID1 | midline 1 | NM_033289.2 | 94.3% | 94.3% | 542_543ins114 |
| 7 | human | 4281 | MID1 | midline 1 | NM_001193279.1 | 70.4% | 63.7% | (many diffs) |
| 8 | human | 4281 | MID1 | midline 1 | NM_001193278.1 | 65.4% | 59.2% | (many diffs) |
| 9 | human | 4281 | MID1 | midline 1 | NM_001193280.1 | 64.7% | 58.1% | (many diffs) |
| 10 | human | 4281 | MID1 | midline 1 | NM_001193281.1 | 33.1% | 32.6% | (many diffs) |
| 11 | mouse | 17318 | Mid1 | midline 1 | NM_001290504.1 | 88.8% | 95.3% | (many diffs) |
| 12 | mouse | 17318 | Mid1 | midline 1 | NM_001290505.1 | 88.8% | 95.3% | (many diffs) |
| 13 | mouse | 17318 | Mid1 | midline 1 | XM_011247789.3 | 88.8% | 95.3% | (many diffs) |
| 14 | mouse | 17318 | Mid1 | midline 1 | XM_030251241.1 | 88.8% | 95.3% | (many diffs) |
| 15 | mouse | 17318 | Mid1 | midline 1 | NM_010797.3 | 87.1% | 93.3% | (many diffs) |
| 16 | mouse | 17318 | Mid1 | midline 1 | XM_017318408.2 | 87.1% | 93.3% | (many diffs) |
| 17 | mouse | 17318 | Mid1 | midline 1 | XM_017318409.2 | 87.1% | 93.3% | (many diffs) |
| 18 | mouse | 17318 | Mid1 | midline 1 | XM_017318410.2 | 87.1% | 93.3% | (many diffs) |
| 19 | mouse | 17318 | Mid1 | midline 1 | XM_030251242.1 | 83.9% | 89.9% | (many diffs) |
| 20 | mouse | 17318 | Mid1 | midline 1 | XM_030251243.1 | 83.9% | 89.9% | (many diffs) |
| 21 | mouse | 17318 | Mid1 | midline 1 | XM_017318413.2 | 83.8% | 90% | (many diffs) |
| 22 | mouse | 17318 | Mid1 | midline 1 | NM_001290506.1 | 83.1% | 89.6% | (many diffs) |
| 23 | mouse | 17318 | Mid1 | midline 1 | XM_030251244.1 | 83.1% | 89.6% | (many diffs) |
| 24 | mouse | 17318 | Mid1 | midline 1 | XM_017318411.2 | 82.3% | 88% | (many diffs) |
| 25 | mouse | 17318 | Mid1 | midline 1 | XM_017318412.2 | 81.5% | 87.7% | (many diffs) |
| 26 | mouse | 17318 | Mid1 | midline 1 | NM_001290512.1 | 59.6% | 63.2% | (many diffs) |
| 27 | mouse | 17318 | Mid1 | midline 1 | XM_006528737.4 | 50% | 52.1% | (many diffs) |
| 28 | mouse | 17318 | Mid1 | midline 1 | XM_006528736.4 | 49% | 51% | (many diffs) |
| 29 | mouse | 17318 | Mid1 | midline 1 | XR_878259.3 | 43.2% | (many diffs) | |
| 30 | mouse | 17318 | Mid1 | midline 1 | XM_006528739.4 | 41% | 44.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2067
- ORF length:
- 2001
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aacactggag tcagaactga cctgccctat ttgtctggag ctctttgagg 121 accctcttct actgccctgc gcacacagcc tctgcttcaa ctgcgcccac cgcatcctag 181 tatcacactg tgccaccaac gagtctgtgg agtccatcac cgccttccag tgccccacct 241 gccggcatgt catcaccctc agccagcgag gtctagacgg gctcaagcgc aacgtcaccc 301 tacagaacat catcgacagg ttccagaaag catcagtgag cgggcccaac tctcccagcg 361 agacccgtcg ggagcgggcc tttgacgcca acaccatgac ctccgccgag aaggtcctct 421 gccagttttg tgaccaggat cctgcccagg acgctgtgaa gacctgtgtc acttgtgaag 481 tatcctactg tgacgagtgc ctgaaagcca ctcacccgaa taagaagccc tttacaggcc 541 atcgtctgat tgagccaatt ccggactctc acatccgggg gctgatgtgc ttggagcatg 601 aggatgagaa ggtgaatatg tactgtgtga ccgatgacca gttaatctgt gccttgtgta 661 aactggttgg gcggcaccgc gatcatcagg tggcagcttt gagtgagcgc tatgacaaat 721 tgaagcaaaa cttagagagt aacctcacca accttattaa gaggaacaca gaactggaga 781 cccttttggc taaactcatc caaacctgtc aacatgttga agtcaatgca tcacgtcaag 841 aagccaaatt gacagaggag tgtgatcttc tcattgagat cattcagcaa agacgacaga 901 ttattggaac caagatcaaa gaagggaagg tgatgaggct tcgcaaactg gctcagcaga 961 ttgcaaactg caaacagtgc attgagcggt cagcatcact catctcccaa gcggaacact 1021 ctctgaagga gaatgatcat gcgcgtttcc tacagactgc taagaatatc accgagagag 1081 tctccatggc aactgcatcc tcccaggttc taattcctga aatcaacctc aatgacacat 1141 ttgacacctt tgccttagat ttttcccgag agaagaaact gctagaatgt ctggattacc 1201 ttacagctcc caaccctccc acaattagag aagagctctg cacagcttca tatgacacca 1261 tcactgtgca ttggacctcc gatgatgagt tcagcgtggt ctcctacgag ctccagtaca 1321 ccatattcac cggacaagcc aacgtcgtta gtctgtgtaa ttcggctgat agctggatga 1381 tagtacccaa catcaagcag aaccactaca cggtgcacgg tctgcagagc ggcaccaagt 1441 acatcttcat ggtcaaggcc atcaaccagg cgggcagccg cagcagtgag cctgggaagt 1501 tgaagacaaa cagccaacca tttaaactgg atcccaaatc tgctcatcga aaactgaagg 1561 tgtcccatga taacttgaca gtagaacgtg atgagtcatc atccaagaag agtcacacac 1621 ctgaacgctt caccagccag gggagctatg gagtagctgg aaatgtgttt attgatagtg 1681 gccggcatta ttgggaagtg gtcataagtg gaagcacatg gtatgccatt ggtcttgctt 1741 acaaatcagc cccGAAGCAT GAATGGATTG GGAAGAACTC TGCTTCCTGG GCGCTCTGCC 1801 GCTGCAACAA TAACTGGGTG GTGAGACACA ATAGCAAGGA AATCCCCATT GAGCCTGCCC 1861 CCCACCTCCG GCGCGTGGGC ATCCTGCTGG ACTATGATAA CGGCTCTATC GCCTTTTATG 1921 ATGCTTTGAA CTCCATCCAC CTCTACACCT TCGACGTCGC ATTTGCGCAG CCTGTTTGCC 1981 CCACCTTCAC CGTGTGGAAC AAGTGTCTGA CGATTATCAC TGGGCTCCCT ATCCCAGACC 2041 ATTTGGACTG CACAGAGCAG CTGCCGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 2101 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2161 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACACTGTGG 2221 AATTACTCCA TAACCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2281 aagatt