Transcript: Human NM_001193278.1

Homo sapiens midline 1 (MID1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MID1 (4281)
Length:
1926
CDS:
57..1679

Additional Resources:

NCBI RefSeq record:
NM_001193278.1
NBCI Gene record:
MID1 (4281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236058 TGTGACCGATGACCAGTTAAT pLKO_005 617 CDS 100% 13.200 18.480 N MID1 n/a
2 TRCN0000019811 CCATCGTCTGATTGAGCCAAT pLKO.1 530 CDS 100% 4.050 5.670 N MID1 n/a
3 TRCN0000019813 CGTCACCCTACAGAACATCAT pLKO.1 284 CDS 100% 4.950 3.960 N MID1 n/a
4 TRCN0000236059 GTAACCTCACCAACCTTATTA pLKO_005 730 CDS 100% 15.000 10.500 N MID1 n/a
5 TRCN0000236055 TTCAGCAAAGACGACAGATTA pLKO_005 1027 CDS 100% 13.200 9.240 N MID1 n/a
6 TRCN0000019812 GCTATGACAAATTGAAGCAAA pLKO.1 700 CDS 100% 4.950 3.465 N MID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01012 pDONR223 100% 65.4% 59.2% None (many diffs) n/a
2 ccsbBroad304_01012 pLX_304 0% 65.4% 59.2% V5 (many diffs) n/a
3 TRCN0000475513 CACTGTGGAATTACTCCATAACCA pLX_317 16% 65.4% 59.2% V5 (many diffs) n/a
Download CSV