Transcript: Human NM_001098624.2

Homo sapiens midline 1 (MID1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MID1 (4281)
Length:
6393
CDS:
332..2335

Additional Resources:

NCBI RefSeq record:
NM_001098624.2
NBCI Gene record:
MID1 (4281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236057 TAAGGTTCAGGCCACTATTTA pLKO_005 2372 3UTR 100% 15.000 21.000 N MID1 n/a
2 TRCN0000236058 TGTGACCGATGACCAGTTAAT pLKO_005 892 CDS 100% 13.200 18.480 N MID1 n/a
3 TRCN0000019811 CCATCGTCTGATTGAGCCAAT pLKO.1 805 CDS 100% 4.050 5.670 N MID1 n/a
4 TRCN0000019813 CGTCACCCTACAGAACATCAT pLKO.1 559 CDS 100% 4.950 3.960 N MID1 n/a
5 TRCN0000236059 GTAACCTCACCAACCTTATTA pLKO_005 1005 CDS 100% 15.000 10.500 N MID1 n/a
6 TRCN0000236056 GAACAAGTGTCTGACGATTAT pLKO_005 2263 CDS 100% 13.200 9.240 N MID1 n/a
7 TRCN0000236055 TTCAGCAAAGACGACAGATTA pLKO_005 1149 CDS 100% 13.200 9.240 N MID1 n/a
8 TRCN0000019809 GCTGGAAATGTGTTTATTGAT pLKO.1 1922 CDS 100% 5.625 3.938 N MID1 n/a
9 TRCN0000019810 CGGCACCAAGTACATCTTCAT pLKO.1 1696 CDS 100% 4.950 3.465 N MID1 n/a
10 TRCN0000019812 GCTATGACAAATTGAAGCAAA pLKO.1 975 CDS 100% 4.950 3.465 N MID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01012 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01012 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475513 CACTGTGGAATTACTCCATAACCA pLX_317 16% 100% 100% V5 n/a
Download CSV